ID: 1184116774

View in Genome Browser
Species Human (GRCh38)
Location 22:42426898-42426920
Sequence GTCCCAGGTGCCACGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184116759_1184116774 26 Left 1184116759 22:42426849-42426871 CCTCGAGCCCTGTCCCTAGGGCC 0: 1
1: 0
2: 0
3: 28
4: 251
Right 1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 167
1184116767_1184116774 -1 Left 1184116767 22:42426876-42426898 CCTCACAGACCCTCCCTGAGGGG 0: 1
1: 0
2: 7
3: 31
4: 281
Right 1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 167
1184116758_1184116774 27 Left 1184116758 22:42426848-42426870 CCCTCGAGCCCTGTCCCTAGGGC 0: 1
1: 0
2: 2
3: 7
4: 133
Right 1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 167
1184116760_1184116774 19 Left 1184116760 22:42426856-42426878 CCCTGTCCCTAGGGCCAAAGCCT 0: 1
1: 0
2: 2
3: 16
4: 145
Right 1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 167
1184116761_1184116774 18 Left 1184116761 22:42426857-42426879 CCTGTCCCTAGGGCCAAAGCCTC 0: 1
1: 0
2: 1
3: 21
4: 183
Right 1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 167
1184116763_1184116774 12 Left 1184116763 22:42426863-42426885 CCTAGGGCCAAAGCCTCACAGAC 0: 1
1: 0
2: 0
3: 18
4: 280
Right 1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 167
1184116764_1184116774 5 Left 1184116764 22:42426870-42426892 CCAAAGCCTCACAGACCCTCCCT 0: 1
1: 0
2: 1
3: 43
4: 327
Right 1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 167
1184116770_1184116774 -10 Left 1184116770 22:42426885-42426907 CCCTCCCTGAGGGGTCCCAGGTG 0: 1
1: 0
2: 6
3: 22
4: 266
Right 1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 167
1184116762_1184116774 13 Left 1184116762 22:42426862-42426884 CCCTAGGGCCAAAGCCTCACAGA 0: 1
1: 0
2: 1
3: 15
4: 148
Right 1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG 0: 1
1: 0
2: 0
3: 17
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184116774 Original CRISPR GTCCCAGGTGCCACGCCCTG AGG Intronic
900409974 1:2508050-2508072 CTCCCAGGGGCCAGGCCCAGCGG + Intergenic
900674750 1:3878098-3878120 GTCCCACGTCCCACACACTGGGG - Intronic
901089179 1:6629996-6630018 GGGCCAGGTGCCAGGCCCTGGGG + Intronic
901823744 1:11847254-11847276 GTCCCAGGGGCCCCGCCCGAGGG + Exonic
902044435 1:13514119-13514141 GACCCAGGTCCCACTCCCTTTGG - Intergenic
902369665 1:15997948-15997970 GTCCCAGGTTCAATGACCTGAGG - Intergenic
903542921 1:24107029-24107051 GTCGCAGGTCCCAGGCCCTGGGG + Intronic
905178356 1:36151926-36151948 CTCCCAGGGCCCACTCCCTGTGG - Intronic
906551751 1:46671336-46671358 TTCCCAGGCCCCAGGCCCTGTGG - Intronic
912588221 1:110786815-110786837 TTCCCAGGTACCAGGACCTGAGG + Intergenic
912735727 1:112147886-112147908 GTCTCAGGTTCCAATCCCTGTGG + Intergenic
913052985 1:115133250-115133272 GTCCTAGATGGCAAGCCCTGAGG + Intergenic
914878482 1:151529855-151529877 GTCTGAGCTGCCACGCCCTGGGG + Intronic
914995483 1:152539806-152539828 GTCCCAGGAGCCCCATCCTGAGG + Intronic
916076422 1:161202427-161202449 GGCCCAGGTGCTGCGGCCTGGGG + Exonic
916519511 1:165551284-165551306 ATCCCAGGTCCTATGCCCTGAGG + Intronic
922339133 1:224641428-224641450 CACCCAGGTGCAACGCCCTGGGG + Intronic
924811623 1:247407742-247407764 GTCCCAGGTGCCAAGCACCTGGG + Intergenic
1062834354 10:626302-626324 ATCCCAGCTGCCAGGCTCTGGGG + Intronic
1065980194 10:30887306-30887328 GACCCAGGTGCTTCTCCCTGTGG + Intronic
1067090530 10:43264016-43264038 GTCCCAGGTGGTGAGCCCTGAGG + Intronic
1069756021 10:70774915-70774937 CTCCCAGGTGCCTAGGCCTGGGG + Intronic
1070721422 10:78759911-78759933 GGCCCAGATGCCAAGCTCTGGGG - Intergenic
1070770484 10:79079617-79079639 GGCCCCAGTGCCAGGCCCTGTGG - Intronic
1074085052 10:110203614-110203636 GTGCTAGGTGCCAGGGCCTGGGG + Intergenic
1074864359 10:117536237-117536259 GTCCCAGGAGCCACACTCTCAGG - Intergenic
1075324184 10:121517532-121517554 GCCCCCGGTGCGACGCCTTGTGG - Intronic
1075332041 10:121580956-121580978 CTCCCAGGTGCCTCGCCTGGGGG - Intronic
1077006556 11:360620-360642 GTCCACGGAGCCAGGCCCTGAGG + Intergenic
1077182627 11:1223434-1223456 CTCCCAGGGGCCTTGCCCTGCGG - Intronic
1079011319 11:16830721-16830743 GTCCCAGGTGCCTGTCCCAGTGG - Intronic
1084099137 11:66933972-66933994 TTCCCAAGTGCTAGGCCCTGAGG + Intronic
1084478331 11:69401390-69401412 GGAGCAGGTGCCAGGCCCTGTGG + Intergenic
1084690110 11:70720161-70720183 CTCCCAGGTACCAGGCCCTGGGG - Intronic
1085523732 11:77152694-77152716 GTGCATGGTGCCAGGCCCTGGGG + Intronic
1086420536 11:86633393-86633415 GTCCAAGGTGCCACAGTCTGGGG + Intronic
1088720480 11:112587864-112587886 TGCCCAGGGGCCAAGCCCTGGGG + Intergenic
1089500469 11:118928957-118928979 GTGGCAGGTGCCAGGCCCTGGGG - Intronic
1091252611 11:134156212-134156234 CTCCCAGGTTCCAGGCACTGTGG + Intronic
1091778371 12:3199233-3199255 CTCCCAGAGGCCAAGCCCTGTGG + Intronic
1092793828 12:12091674-12091696 CTCCCAGGTGCTTCGCCCTCTGG - Intronic
1101904514 12:108814777-108814799 CTCCCAGGTCCCTCTCCCTGTGG - Intronic
1102209288 12:111112931-111112953 GTCCAAAGTGCCAAGCACTGAGG - Intronic
1102252518 12:111397162-111397184 GTCCCAGGCATCAGGCCCTGAGG - Intergenic
1103415640 12:120740206-120740228 TCCCCAGGGGCCACTCCCTGAGG - Intergenic
1104639881 12:130460765-130460787 GTCCCCGGCGCCAGGCCCTGGGG - Intronic
1104745146 12:131205749-131205771 ATTGCAGGTGCCACGCTCTGTGG + Intergenic
1104776387 12:131392470-131392492 GTCTCAGGTGCCAGGGCATGGGG + Intergenic
1104976233 12:132553179-132553201 GTCCCAGGTGCCACCGTCTCTGG + Intronic
1106435676 13:29721276-29721298 GAGCCAGGGGCCAGGCCCTGTGG - Intergenic
1108682588 13:52792322-52792344 GACACAGGGGCCAAGCCCTGGGG + Intergenic
1110335423 13:74324379-74324401 GTCCAAGGTGCCATGGCCAGAGG + Intergenic
1110694050 13:78466369-78466391 GACCCAGGTACCAAGCCCTCAGG + Intergenic
1113965385 13:114150219-114150241 CACCCAGGTGCCAAGCACTGGGG - Intergenic
1117282994 14:54258684-54258706 CCACCAGGTGCCAGGCCCTGGGG + Intergenic
1120676908 14:87431282-87431304 GGCCCATGTGCCACACTCTGAGG - Intergenic
1122271583 14:100570709-100570731 GGCCGAGGTGCTACGCCCTCGGG + Intronic
1122959772 14:105089185-105089207 GTCTCAGATGCCAGTCCCTGGGG + Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1129727355 15:77908359-77908381 GTCCCAGGTGCGCCCCCGTGTGG - Intergenic
1129824423 15:78625314-78625336 GTCACAGGTGCCAAGTACTGGGG + Intronic
1129840524 15:78740627-78740649 GTCCCAGGTGCGCCCCCGTGTGG + Intergenic
1131062360 15:89411704-89411726 GTCCCTGGCGCCACGCTGTGGGG + Intergenic
1132018439 15:98339361-98339383 GTCCCAGGATCCAGGGCCTGCGG + Intergenic
1132909288 16:2299989-2300011 GTCCAAGGTGCCGCCTCCTGTGG - Exonic
1134512935 16:14863516-14863538 GTCCCAGAAGCCACGCACTATGG - Intronic
1134700573 16:16262005-16262027 GTCCCAGAAGCCACGCACTATGG - Intronic
1134971253 16:18532654-18532676 GTCCCAGAAGCCACGCACTATGG + Intronic
1137790357 16:51169965-51169987 GTGACAGGTGCCAACCCCTGAGG + Intergenic
1139592608 16:67941936-67941958 GGCCCTGGTGCCACTCCCTAGGG + Intronic
1142853275 17:2715613-2715635 GTAGAAGGTGCCAGGCCCTGAGG + Intergenic
1144734471 17:17547307-17547329 CTGCCAAGTGCCAGGCCCTGGGG + Intronic
1144846898 17:18224903-18224925 GTCCCAAATGCCACCTCCTGGGG + Intergenic
1145009640 17:19360568-19360590 CTCCCAGGTGCCACGGCCCCTGG + Intronic
1145321072 17:21767766-21767788 GTGCCATGGGCCAAGCCCTGTGG + Intergenic
1145366606 17:22270981-22271003 ATCCCAGGGGCCAGGCCCTAAGG + Intergenic
1145783858 17:27581583-27581605 CTCCCAGGTGCCACCTCCTCTGG + Intronic
1148495524 17:48051394-48051416 GTTCCAGGTGCCAACCACTGAGG + Exonic
1149867992 17:60161303-60161325 GCCCCAGGTGCCAGGAACTGAGG + Intronic
1152013335 17:77734425-77734447 GTGCCACGTGCCAGGGCCTGGGG - Intergenic
1152532119 17:80924757-80924779 GTCTCCTGTGCCACGCCATGTGG - Intronic
1152539999 17:80970047-80970069 TTCCCAGCTCCCAAGCCCTGTGG - Intergenic
1154389694 18:13925666-13925688 GGCCCAGGTGCCTGCCCCTGAGG - Intergenic
1160424247 18:78769425-78769447 GTCCCTGGGGCCCTGCCCTGCGG - Intergenic
1160569651 18:79808049-79808071 GTCCCAGAGTCCTCGCCCTGAGG + Intergenic
1160569936 18:79809429-79809451 GTCCCAGAGTCCTCGCCCTGAGG + Intergenic
1160569976 18:79809609-79809631 GTCCCAGAGTCCTCGCCCTGAGG + Intergenic
1161028245 19:2046471-2046493 GTTCCAGGAGGCACGCCCAGGGG + Intronic
1161558594 19:4958133-4958155 GCCCCACCTGCCTCGCCCTGTGG + Intronic
1162905889 19:13823681-13823703 GTCCCAGATCCCCTGCCCTGTGG + Intronic
1163157382 19:15446855-15446877 CTTCTAGGGGCCACGCCCTGGGG - Intronic
1163189634 19:15667091-15667113 GCCCCAGGCGGCAGGCCCTGTGG - Intergenic
1163221385 19:15923940-15923962 GCACCAGGTGGCAGGCCCTGCGG + Exonic
1165115695 19:33527255-33527277 GTGCCAGCTGCCATGTCCTGGGG - Intergenic
1165329107 19:35131584-35131606 GACCCGGCTTCCACGCCCTGGGG + Intronic
1165394018 19:35554255-35554277 GTCACAGGTCCCACAGCCTGTGG - Intronic
1165757988 19:38305142-38305164 GTAACAGCGGCCACGCCCTGGGG + Exonic
1166293748 19:41878990-41879012 GCCCTGGGTGCCAGGCCCTGTGG + Exonic
1167463851 19:49640037-49640059 GGCCCAGGTCCCCCGCCCCGGGG + Exonic
925424459 2:3737112-3737134 CCCCCAGGTGCCAGGCCCTGGGG + Intronic
929950669 2:46407363-46407385 CTACCAGGTGCCAAGCACTGTGG + Intergenic
936155227 2:110042720-110042742 GTCTCATGTGCCAGGCCCTGGGG - Intergenic
936189454 2:110328693-110328715 GTCTCATGTGCCAGGCCCTGGGG + Intergenic
937150610 2:119683281-119683303 GTCCTAGGTACCAGGGCCTGGGG - Intronic
937873381 2:126802444-126802466 GACCCAGGAGCCCCGCACTGGGG + Intergenic
937921995 2:127137405-127137427 GTCCCAGGGGACAGGCCCGGGGG + Intergenic
938685071 2:133730184-133730206 GCCCCAGGTGACCTGCCCTGGGG - Intergenic
943060452 2:183037800-183037822 GTCCCGGGCGCCTCTCCCTGTGG - Intronic
943743476 2:191436753-191436775 GTCCCAGATGTCAGGCCCCGAGG + Intergenic
945092627 2:206189816-206189838 GTCCCAAATACCACCCCCTGGGG - Intronic
945237168 2:207641958-207641980 ATCCCAGGGGCCACAGCCTGGGG - Intergenic
946207017 2:218117097-218117119 ATACCAGGTGCCACTCCTTGAGG - Intergenic
946784368 2:223227023-223227045 GTCCCAGGGGCCAGGCGCGGTGG + Intergenic
948627314 2:239277038-239277060 GTCCCAGGTGCCACCAGCAGGGG - Intronic
948777855 2:240299191-240299213 GTCACAGGTGCCAAGACATGCGG - Intergenic
948778236 2:240301069-240301091 GTCCCCTGTGCCAGGCCCTGGGG - Intergenic
948787392 2:240359580-240359602 GTCCCTTGTGCCAGGCCCGGAGG - Intergenic
1169204745 20:3733235-3733257 GGCCCAGGTGCCAGGGTCTGAGG + Intronic
1169805401 20:9554346-9554368 GACCCAGTTGCCATGCCATGAGG + Intronic
1173118014 20:40264498-40264520 TTCCAAGGTGCCCTGCCCTGTGG - Intergenic
1173805989 20:45925710-45925732 GGCCCAAGAGCCACTCCCTGTGG + Intergenic
1176016133 20:62934116-62934138 GTCCCAGATGCCAACCCGTGTGG + Intronic
1181220132 22:21360773-21360795 GTCCCCCGCGCCACGCCCCGCGG - Intergenic
1181639324 22:24188510-24188532 GTCCCAGGTGTCTGGTCCTGGGG - Exonic
1184102702 22:42349118-42349140 GGCCAAGGAGCCAGGCCCTGGGG - Intergenic
1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG + Intronic
1185068999 22:48646150-48646172 CTCCAAAGTGCCACACCCTGGGG + Intronic
950039889 3:9913700-9913722 GTCCTCTGTGCCAAGCCCTGAGG - Intronic
950109994 3:10412724-10412746 GCTTCAGGTGCCAGGCCCTGAGG - Intronic
951604836 3:24421595-24421617 GTCCTGGGTGGCACGTCCTGTGG - Intronic
961340433 3:126213538-126213560 GCCCCAGGCGCCAGGCCCTGCGG - Intergenic
961381466 3:126498774-126498796 GTCCCATGTGGCACCCACTGAGG + Intronic
963247292 3:143074954-143074976 GGCCCAGGGGCCAAGCCCTGGGG + Intergenic
963831598 3:150014895-150014917 CTCCCAGGTGGCTGGCCCTGTGG + Intronic
968266364 3:197366495-197366517 ATACCAGGTGCCCAGCCCTGGGG - Intergenic
972822308 4:42715922-42715944 GCCCAAGGTGCCAAGCTCTGAGG + Intergenic
975612250 4:76214135-76214157 CTCCCATGGGCCACGCGCTGGGG + Intronic
984155993 4:176196596-176196618 GAGCCAGGTGACAGGCCCTGTGG + Intergenic
985112025 4:186555624-186555646 GGCCCAGCCGCCGCGCCCTGGGG + Intergenic
985727901 5:1525260-1525282 GTCCCAAGTGCCACACCCACGGG + Intergenic
986574655 5:9199288-9199310 GTCCCCTGTGCCATCCCCTGGGG + Intronic
999637038 5:153633851-153633873 CTCCCATGTGCCAGGCACTGTGG + Intronic
1001282983 5:170401192-170401214 GTCCCAGGAGCTACTTCCTGTGG + Intronic
1001618034 5:173057504-173057526 GTCCCAGGAACCACCCCCAGGGG - Intronic
1002559624 5:180072303-180072325 CTCCCGGGCTCCACGCCCTGCGG - Intergenic
1002815010 6:671461-671483 GTGCCAGATGCCAGGACCTGAGG + Intronic
1002925577 6:1604352-1604374 AAACCAGGTGCCAGGCCCTGCGG + Intergenic
1003261190 6:4517548-4517570 GTCCCAGGTGTGGCGGCCTGTGG + Intergenic
1003321591 6:5057220-5057242 GGCCCACGAGCCACACCCTGAGG + Intergenic
1006934145 6:37705669-37705691 GGCCCTGCTGCCACGCCCTCGGG + Intergenic
1012752892 6:103185003-103185025 GACCCAGGTGCAAAGCACTGAGG - Intergenic
1013516236 6:110888668-110888690 TTACCATGTGCCAAGCCCTGGGG + Intronic
1015565222 6:134563134-134563156 CTCCCAGGGGCCAAACCCTGGGG + Intergenic
1018640455 6:165899726-165899748 GTACCAGGTGCTGCGTCCTGTGG + Intronic
1019317152 7:391983-392005 GGCCCAGGTGCCAAGCCCAGGGG - Intergenic
1019521740 7:1463780-1463802 GACCCAGGTGCCACACCCGGAGG + Intergenic
1019648134 7:2141827-2141849 GTCCCGGGAGCCAGGCCATGTGG - Intronic
1019659865 7:2218230-2218252 GTCCCAGGCCCCAGCCCCTGTGG + Intronic
1020115227 7:5472458-5472480 GACCCAGCTGCCACGCTGTGAGG + Intronic
1023176838 7:37443835-37443857 GTCCTGGGAGCCACACCCTGTGG + Intronic
1024612747 7:51081308-51081330 GTCCCAGGTGCCTGTACCTGGGG + Intronic
1024766713 7:52668841-52668863 GCCCCAGGTGCCACGTGTTGAGG + Intergenic
1024942261 7:54775277-54775299 CACCCAGGTTCCACGCACTGTGG + Intergenic
1024980816 7:55156184-55156206 CTGCCAGGTGCCCAGCCCTGGGG + Intronic
1026827468 7:73593537-73593559 GTCACAGCTGCCAAGGCCTGGGG + Exonic
1026950335 7:74342479-74342501 ATCCCAGGTCCCTGGCCCTGTGG - Intronic
1027127233 7:75565420-75565442 GTCCAAGGAGACAGGCCCTGAGG - Intronic
1029275795 7:99403657-99403679 GGCCCAGGTCCCATTCCCTGGGG - Intronic
1030511753 7:110491516-110491538 GTACCAGGTGCCCCGGCATGAGG - Intergenic
1031483781 7:122305893-122305915 GGCCGAGGTGCCACACCCGGCGG - Intronic
1040482169 8:47836125-47836147 GTGCCAGGTGCCAGGGTCTGGGG - Intronic
1045245061 8:100435452-100435474 GACCCTGGAGCCACACCCTGGGG - Intergenic
1049039939 8:140104980-140105002 GTCCCAGGAGCCACGCAGTCAGG - Intronic
1049156012 8:141067290-141067312 GTGCCAGGGGCCACATCCTGAGG - Intergenic
1055088468 9:72338195-72338217 CTCCCATGTGCCAAGCCCTCTGG - Intergenic
1055212408 9:73812666-73812688 GTAAAAGGTGCCAGGCCCTGCGG + Intergenic
1055508500 9:76971391-76971413 GTCCCATGGGCCAAACCCTGAGG - Intergenic
1057282036 9:93720176-93720198 TGCCCAGGTGGCATGCCCTGGGG - Intergenic
1060730360 9:126033337-126033359 ATCCCAGTTGCCAGGCCCTTGGG + Intergenic
1060785510 9:126449148-126449170 CTCCCATGTGCCCAGCCCTGGGG + Intronic
1060904459 9:127292358-127292380 GTCCCAGGGGCCAGGCCATTTGG - Intronic
1062636969 9:137496760-137496782 CTCCAAGGTGCCACGGCCTGGGG - Intronic
1190227927 X:48560285-48560307 GTCGCACGGGCCACCCCCTGTGG - Exonic
1194033202 X:88840612-88840634 GTCAGAGGTGCCTCACCCTGTGG - Intergenic
1199708439 X:150451055-150451077 GACCCAGATGCCAAGCCCAGTGG - Intronic