ID: 1184116840

View in Genome Browser
Species Human (GRCh38)
Location 22:42427156-42427178
Sequence GTGGGCAACAGGACCCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184116840_1184116853 27 Left 1184116840 22:42427156-42427178 CCCATCTGGGTCCTGTTGCCCAC No data
Right 1184116853 22:42427206-42427228 GATCCACAAGGAGCAAGCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 194
1184116840_1184116851 15 Left 1184116840 22:42427156-42427178 CCCATCTGGGTCCTGTTGCCCAC No data
Right 1184116851 22:42427194-42427216 TGGCCTTGCTTAGATCCACAAGG 0: 1
1: 0
2: 0
3: 14
4: 110
1184116840_1184116846 -5 Left 1184116840 22:42427156-42427178 CCCATCTGGGTCCTGTTGCCCAC No data
Right 1184116846 22:42427174-42427196 CCCACGTCCCCACTAGGGTATGG 0: 1
1: 0
2: 0
3: 4
4: 92
1184116840_1184116844 -10 Left 1184116840 22:42427156-42427178 CCCATCTGGGTCCTGTTGCCCAC No data
Right 1184116844 22:42427169-42427191 TGTTGCCCACGTCCCCACTAGGG 0: 1
1: 0
2: 1
3: 8
4: 51
1184116840_1184116854 28 Left 1184116840 22:42427156-42427178 CCCATCTGGGTCCTGTTGCCCAC No data
Right 1184116854 22:42427207-42427229 ATCCACAAGGAGCAAGCAGAGGG 0: 1
1: 0
2: 2
3: 19
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184116840 Original CRISPR GTGGGCAACAGGACCCAGAT GGG (reversed) Intronic
No off target data available for this crispr