ID: 1184117123

View in Genome Browser
Species Human (GRCh38)
Location 22:42428687-42428709
Sequence GTCCCTCTGGTGCCTAGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184117120_1184117123 -1 Left 1184117120 22:42428665-42428687 CCTATGGCTTGTTCACGTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1184117123 22:42428687-42428709 GTCCCTCTGGTGCCTAGAACCGG 0: 1
1: 0
2: 2
3: 13
4: 145
1184117117_1184117123 16 Left 1184117117 22:42428648-42428670 CCAGGCTGAGAGTGGGGCCTATG 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1184117123 22:42428687-42428709 GTCCCTCTGGTGCCTAGAACCGG 0: 1
1: 0
2: 2
3: 13
4: 145
1184117116_1184117123 19 Left 1184117116 22:42428645-42428667 CCACCAGGCTGAGAGTGGGGCCT 0: 1
1: 0
2: 3
3: 32
4: 370
Right 1184117123 22:42428687-42428709 GTCCCTCTGGTGCCTAGAACCGG 0: 1
1: 0
2: 2
3: 13
4: 145
1184117115_1184117123 20 Left 1184117115 22:42428644-42428666 CCCACCAGGCTGAGAGTGGGGCC No data
Right 1184117123 22:42428687-42428709 GTCCCTCTGGTGCCTAGAACCGG 0: 1
1: 0
2: 2
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184117123 Original CRISPR GTCCCTCTGGTGCCTAGAAC CGG Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
902308892 1:15565243-15565265 GAACCTCTGGTGCCCAGCACAGG + Intronic
903183433 1:21616796-21616818 GTATACCTGGTGCCTAGAACAGG + Intronic
903334554 1:22616331-22616353 GTCTCCCCAGTGCCTAGAACTGG + Intergenic
904593072 1:31626078-31626100 GCCTCTCTGGTGCCCAGCACAGG - Intronic
906750242 1:48252221-48252243 GTACCCCTAGTGCCTGGAACAGG - Intergenic
907547464 1:55274734-55274756 GTCCGTCTGGTGCCAAGTTCAGG - Intergenic
912062172 1:105686991-105687013 CTCACTCTGGTCCCTGGAACTGG + Intergenic
912704068 1:111898977-111898999 GTCCCACTAGTGCCAGGAACAGG + Intronic
913019474 1:114773737-114773759 GTCTCTCTGGTGCTAAGAATTGG - Exonic
914397696 1:147286538-147286560 GTCCTTATGGTGCCAAGAACTGG + Intronic
914458009 1:147854887-147854909 TTCCCTCAGGTGCCTACACCTGG + Intergenic
914462630 1:147898902-147898924 ATCCCTCTGGTGACTGGAATTGG - Intergenic
915536300 1:156537925-156537947 CTCACTCTGTTGCCTAGAGCTGG + Intronic
916478793 1:165196210-165196232 GTTGCACTGGTGGCTAGAACTGG + Intergenic
920276952 1:204813611-204813633 GTCACTATGGTGCCTAGGACTGG - Intergenic
921943155 1:220864061-220864083 TTCCCTCTGGTGCCTGGCTCGGG - Intergenic
924456045 1:244219642-244219664 GTTCCTCTGGTGCCCAGCCCAGG + Intergenic
1065962375 10:30744061-30744083 GGGCCTCTGTTGCCTAGAATGGG - Intergenic
1067981946 10:51097025-51097047 GTCCCTCTGGTACCTACAGTGGG + Intronic
1069548364 10:69344869-69344891 CTCCCTCTGCTGCCTACAGCAGG - Intronic
1069667699 10:70174565-70174587 GTCCCTCTGGTGCAGGGGACAGG - Intergenic
1070537401 10:77390013-77390035 GTTCTCCTGGTGCCTAGCACAGG + Intronic
1070794816 10:79210386-79210408 GTCCCTCTGGGGCCCAGCACAGG - Intronic
1073324767 10:102636064-102636086 GTATCCCTGGTGCCTAGAATGGG - Intergenic
1073606597 10:104901807-104901829 TTCCCACTGGTGCCTAGATTAGG + Intronic
1075157738 10:119992674-119992696 GTACCTCTGGAACCAAGAACTGG - Intergenic
1075526758 10:123193680-123193702 GGCCCTCTTGTTCCTAGAAAAGG + Intergenic
1076449234 10:130544893-130544915 GTCCCTCTAGAGCCGAGCACAGG - Intergenic
1080873088 11:36253853-36253875 GTTCTTCTGGTACCTAGCACAGG - Intergenic
1083492668 11:63024250-63024272 CTCCCTCTGGTGGCTATAGCGGG + Intergenic
1083800873 11:65045637-65045659 GTCCCTCTGGGAGCTAGGACTGG - Intronic
1084007631 11:66331757-66331779 GTCCTTCTGGTGTCCAGGACAGG + Intronic
1084372641 11:68754093-68754115 GTCTCCCCAGTGCCTAGAACAGG + Intergenic
1090957924 11:131530178-131530200 GACCCTCTGGTGCCTGGCACAGG + Intronic
1091207453 11:133831521-133831543 GGCTCTCTGGGGCCTAGAATGGG - Intergenic
1092951449 12:13507396-13507418 GTGCCTCATGTGCCTAGGACAGG - Intergenic
1096550136 12:52366875-52366897 TTCCCTCTGCTGCCTCAAACCGG + Intronic
1096809530 12:54160648-54160670 GTCTCTCTGGATCCTGGAACAGG + Intergenic
1097226290 12:57478490-57478512 GTCTGTCCTGTGCCTAGAACAGG + Intronic
1099076336 12:78113607-78113629 GTCCCTATGGTGCATACAGCAGG + Intronic
1100615564 12:96229060-96229082 GTCGCTCTGGTACCTCGGACAGG + Intronic
1106080730 13:26498425-26498447 TCCCCTCTGGTGGCAAGAACTGG + Intergenic
1112349101 13:98618216-98618238 TTCTCTGTGGTGCCTAAAACAGG + Intergenic
1112809965 13:103206874-103206896 GTCCTGCTGGTGCCTGGATCTGG + Intergenic
1117377011 14:55126232-55126254 GTCTTTCTGGTGCCAACAACTGG - Intronic
1118989689 14:70786577-70786599 GTCCCCCTGGTTCCTCGAATGGG + Intronic
1121242727 14:92441628-92441650 GCATCCCTGGTGCCTAGAACAGG - Intronic
1123782561 15:23642836-23642858 GTCCCTTTCCTGCCTAGACCAGG + Intergenic
1124501236 15:30228104-30228126 GTTACCCTGGTGACTAGAACAGG - Intergenic
1124742333 15:32310563-32310585 GTTACCCTGGTGACTAGAACAGG + Intergenic
1125065260 15:35475716-35475738 GTCCCTCTGGTGCTTTAAATTGG - Intronic
1127396114 15:58545267-58545289 CTCCCTCTGTTGCCTAGACTGGG + Intronic
1130106730 15:80934382-80934404 GTCTAGATGGTGCCTAGAACAGG + Intronic
1132483459 16:177817-177839 GGCACTCTTGTGCCAAGAACTGG + Intergenic
1136629409 16:31480725-31480747 TTCTCCCTGGTGTCTAGAACAGG + Intergenic
1138023492 16:53504302-53504324 GTGCCTCTGGTGTCTAGAAAAGG - Intronic
1143037404 17:4007308-4007330 CTCCCTCTGGTCCCCAGCACTGG - Intronic
1145070288 17:19799938-19799960 GTCCCTCTGGTGCCAAGGCTAGG + Intronic
1147661305 17:42118453-42118475 GTCCCTCTGCTGCCTGGCCCAGG - Intronic
1149012497 17:51871796-51871818 GACCCTCTGGTACATAGAAAAGG - Intronic
1149599014 17:57881440-57881462 GACTCTCTGGTGCCTGGCACAGG + Intronic
1151458658 17:74241814-74241836 CTCCCGCTGGTGCCCAGCACAGG + Intronic
1152180529 17:78818180-78818202 GTCCTTTTGATGTCTAGAACAGG - Intronic
1152468496 17:80478179-80478201 GTCCCTCTGGCGCCAGGAAGCGG - Intergenic
1155471507 18:26196809-26196831 GTCTCTCTGTTGCCCAGAACTGG - Intergenic
1156803384 18:41146023-41146045 GCCCTTCTTGTGCCTAGAATGGG - Intergenic
1158106291 18:53888504-53888526 CTCACTCTGGTGTCTAGGACTGG - Intergenic
1161383305 19:3977764-3977786 GTCCCTCTAGAGCCTGGAAACGG + Intronic
1161955846 19:7494558-7494580 GTATCTCTGTTGCCTAGAGCGGG - Intronic
1162846727 19:13398479-13398501 GGATCTCTGGTGTCTAGAACAGG + Intronic
1164913967 19:32035113-32035135 ATCCCCCTGGAGCCTAAAACAGG + Intergenic
1166662868 19:44658582-44658604 CACCCTCTGGTGCCCAGAATGGG - Intronic
1167006987 19:46782613-46782635 GTCCCAGTGGTGCCAAGGACAGG - Intronic
1167468131 19:49660928-49660950 GGCCCTCTGCTGCCTCGACCAGG + Intronic
925031935 2:656975-656997 GTCCCACTGGTGGCTAGGAATGG + Intergenic
925206726 2:2013492-2013514 GGCCCACTGGAGCCTGGAACCGG + Intronic
926224422 2:10956784-10956806 GTCACTCTTGTGCCCAGATCTGG - Intergenic
927081313 2:19633614-19633636 GTCCTTCTGGTGGCTGGACCAGG - Intergenic
927131426 2:20063696-20063718 GTCCCTCTGGGGGTAAGAACTGG + Intergenic
927688622 2:25191290-25191312 GTGTCCCTAGTGCCTAGAACAGG - Intergenic
929962319 2:46506157-46506179 GTCCCTGTGGAGCCTAGGAAGGG + Intronic
932403264 2:71496591-71496613 GGCCCTATGGTGCTTAGGACAGG + Intronic
933733071 2:85472591-85472613 GTATCCCTGGTGCCTACAACAGG + Intergenic
934489334 2:94749038-94749060 GTCCTTGTTGTTCCTAGAACAGG + Intergenic
934895627 2:98117408-98117430 GTAACCCTGGGGCCTAGAACTGG + Intronic
935336882 2:102024330-102024352 GTACCTCTGGTTCCTACAACTGG - Intronic
940664406 2:156589984-156590006 GTCCCTCTACTTCCCAGAACAGG - Intronic
941499285 2:166249349-166249371 CTCCCTCCAGTGCCTGGAACTGG + Intronic
947145360 2:227059366-227059388 GTCCTTTTGGTGCATAGAGCTGG - Intronic
948223419 2:236290924-236290946 GTGACCCTGGTGCCTGGAACAGG - Intergenic
948965563 2:241376923-241376945 GTGCCTCTGGTGTTTGGAACAGG + Intronic
949042040 2:241853961-241853983 GTCCCTCTGCTTCCTGGGACAGG + Intronic
1169787142 20:9371022-9371044 GTCCCTCTGGTTCCCAGAGCTGG - Intronic
1170842980 20:19939071-19939093 CTCGCTCTGTTGCCTAGAGCTGG + Intronic
1172314650 20:33944187-33944209 GCCCCTCTGGAGCCTAGTTCAGG - Intergenic
1173139255 20:40467868-40467890 TTCGCTCTGGTGCCTTGAGCTGG + Intergenic
1178510722 21:33202822-33202844 GTCCCTCTGGTGCCTCCACACGG - Intergenic
1178538654 21:33431046-33431068 ATCCCTCTGCTGCCTTGAGCAGG - Intronic
1179679000 21:43004825-43004847 GCCCCTCTCATGCCTACAACTGG - Intronic
1180611554 22:17101514-17101536 GTACCTCCAGTGCCAAGAACAGG + Intronic
1181717671 22:24744867-24744889 GTCCCTCTGGTGTATAGTGCAGG - Intronic
1182559554 22:31149078-31149100 GGCCCTCTGATGCCCAGACCAGG + Intergenic
1183434377 22:37784940-37784962 GTCACTCAGGTGCCTGGAACAGG - Intergenic
1183641405 22:39095145-39095167 GACCCTGTGGTGTCTAGGACGGG - Intergenic
1183867389 22:40714586-40714608 ATCCCCCTGCTGCCAAGAACGGG - Intergenic
1184113328 22:42408232-42408254 GTATCCCTGGTGCCTAGAACAGG + Intronic
1184117123 22:42428687-42428709 GTCCCTCTGGTGCCTAGAACCGG + Intronic
950008611 3:9706457-9706479 GAAGCCCTGGTGCCTAGAACAGG - Intronic
950433591 3:12965915-12965937 GTGTCTCTGGTGCCTAGAGCAGG + Intronic
950520754 3:13496442-13496464 TGCCCTCTTGTGCCCAGAACAGG - Intronic
950524047 3:13513262-13513284 TTCCCTCTGGTTCCAAGACCAGG - Intergenic
954302364 3:49706686-49706708 GGCCCTCTAGTGCCTGGAGCAGG - Intronic
959685845 3:109145403-109145425 TTACATGTGGTGCCTAGAACAGG + Intergenic
962991896 3:140585223-140585245 GTGTCTCTGGTGCTTAGCACAGG - Intergenic
967953192 3:194856712-194856734 GCCCCTCTGGTGTTTAGAGCTGG - Intergenic
968964880 4:3764821-3764843 GTCCATCCTGTGGCTAGAACCGG - Intergenic
969243938 4:5920369-5920391 GTGCGCCTGGTGCCTATAACAGG + Intronic
970601965 4:17647733-17647755 GTCCTTCTGGTGCCCAGAACAGG + Exonic
972847081 4:43003649-43003671 GTTCCACAGGTCCCTAGAACAGG - Intronic
972848852 4:43023693-43023715 TTACTTCTAGTGCCTAGAACAGG + Intronic
975334615 4:73161566-73161588 GACCCTCTGGTGCCAGAAACGGG + Intronic
976020344 4:80616180-80616202 GTATCTATGGTGCCTAGGACTGG + Intronic
978150668 4:105430608-105430630 GACACTCTGTTGCCTAGATCAGG - Intronic
981256335 4:142664393-142664415 GTCCCTTCTGTGCCTAGAACAGG + Intronic
995132679 5:108647105-108647127 GTTCCACAGGTTCCTAGAACAGG - Intergenic
995223160 5:109673840-109673862 GTCCCTGTGGTGCTTGGCACAGG - Intergenic
995590607 5:113695964-113695986 GTCCCACAGGTGCCTACAAATGG + Intergenic
999174678 5:149623699-149623721 GTCCCTGTGGAGCCTGGAAAAGG + Intronic
1007732011 6:43953153-43953175 GCCGTTCTAGTGCCTAGAACAGG + Intergenic
1008534766 6:52499477-52499499 GACCCCCTTGTGCCTAGAAAAGG - Exonic
1008559811 6:52712887-52712909 GTACCTCTAGTGCCTAGCATTGG - Intergenic
1011135474 6:84095262-84095284 CTCCCTCTGGAGCATAGAGCAGG - Intergenic
1013587145 6:111589616-111589638 GAGCCTCTGATGCCTAAAACTGG - Intronic
1016406052 6:143731947-143731969 GGCCCTCTGGTGCTTTGAAATGG + Intronic
1017118737 6:151003816-151003838 GTCCCTCTGATGCCCAGCCCAGG - Intronic
1019162863 6:170080713-170080735 GTGCCTGTGGTGCCCACAACAGG - Intergenic
1019520166 7:1457257-1457279 GCACCCCTGGTGCCTGGAACTGG - Intronic
1020063550 7:5170337-5170359 GTCCCTCTGGTTCCTAGAATTGG + Intergenic
1023601963 7:41889263-41889285 GGCCCTCTCCTGGCTAGAACAGG + Intergenic
1023985198 7:45089813-45089835 GTCTCCCTGGTGCCTGGCACGGG - Intergenic
1028966352 7:96805970-96805992 GTCCCTCTGGGTCCTAGGAGTGG - Intergenic
1029283150 7:99449583-99449605 GTCCCTCCAGTGCCTGGAAAGGG - Intronic
1035154539 7:156901485-156901507 GTACATCTGGTAGCTAGAACTGG + Intergenic
1035483538 7:159205003-159205025 GTCCCTGTGGAGCCTGGCACTGG + Intergenic
1041078274 8:54188785-54188807 TTCCCTCTGGAGCAAAGAACAGG + Intergenic
1042934748 8:74047252-74047274 GTCCCTCTAGTGCAGAAAACGGG - Intergenic
1048309304 8:133306186-133306208 TTCCCTGTGTTGCCTAGAATTGG - Intergenic
1049596299 8:143485170-143485192 GTCCCCCTGGTGCTGAGAACAGG + Intronic
1053668450 9:40335245-40335267 GTCCTTGTTGTTCCTAGAACAGG - Intergenic
1053918250 9:42961542-42961564 GTCCTTATTGTTCCTAGAACAGG - Intergenic
1054379590 9:64475297-64475319 GTCCTTGTTGTTCCTAGAACAGG - Intergenic
1060573545 9:124666742-124666764 GTGTGCCTGGTGCCTAGAACAGG - Intronic
1188162061 X:26816066-26816088 GTCACCCTGATGCCTAAAACAGG - Intergenic
1190257464 X:48774230-48774252 GTCTCTCCAGTGCCTGGAACAGG - Intergenic
1190271124 X:48864662-48864684 CTTGCTCTGTTGCCTAGAACTGG + Intergenic
1193296077 X:79831842-79831864 ACCTCTCTGGTGCCCAGAACAGG + Intergenic
1195774843 X:108391632-108391654 TTCCCTCTGGTGCCTGGCTCGGG - Intronic
1196467592 X:115989000-115989022 CTCCCTCTGGTGCCCAAAAGGGG - Intergenic
1200312961 X:155098477-155098499 TTTCCTCTGTTACCTAGAACAGG + Intronic