ID: 1184118868

View in Genome Browser
Species Human (GRCh38)
Location 22:42437739-42437761
Sequence CTTGCTAGGCGGTGGCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184118868_1184118879 11 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118879 22:42437773-42437795 GCTTGAGCGGCAGTGGGATAGGG No data
1184118868_1184118881 18 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118881 22:42437780-42437802 CGGCAGTGGGATAGGGCAGTGGG No data
1184118868_1184118883 20 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118883 22:42437782-42437804 GCAGTGGGATAGGGCAGTGGGGG No data
1184118868_1184118880 17 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118880 22:42437779-42437801 GCGGCAGTGGGATAGGGCAGTGG No data
1184118868_1184118876 4 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118876 22:42437766-42437788 AGATAGGGCTTGAGCGGCAGTGG No data
1184118868_1184118888 30 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118888 22:42437792-42437814 AGGGCAGTGGGGGTTCCGGGGGG No data
1184118868_1184118878 10 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118878 22:42437772-42437794 GGCTTGAGCGGCAGTGGGATAGG No data
1184118868_1184118885 27 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118885 22:42437789-42437811 GATAGGGCAGTGGGGGTTCCGGG No data
1184118868_1184118882 19 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118882 22:42437781-42437803 GGCAGTGGGATAGGGCAGTGGGG No data
1184118868_1184118875 -2 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118875 22:42437760-42437782 AGATCAAGATAGGGCTTGAGCGG No data
1184118868_1184118886 28 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118886 22:42437790-42437812 ATAGGGCAGTGGGGGTTCCGGGG No data
1184118868_1184118877 5 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118877 22:42437767-42437789 GATAGGGCTTGAGCGGCAGTGGG No data
1184118868_1184118887 29 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118887 22:42437791-42437813 TAGGGCAGTGGGGGTTCCGGGGG No data
1184118868_1184118884 26 Left 1184118868 22:42437739-42437761 CCCTGAGGCCACCGCCTAGCAAG No data
Right 1184118884 22:42437788-42437810 GGATAGGGCAGTGGGGGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184118868 Original CRISPR CTTGCTAGGCGGTGGCCTCA GGG (reversed) Intergenic
No off target data available for this crispr