ID: 1184119542

View in Genome Browser
Species Human (GRCh38)
Location 22:42441103-42441125
Sequence CTGGAGAAGGGGAGGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184119542_1184119555 16 Left 1184119542 22:42441103-42441125 CCACCCAGCCTCCCCTTCTCCAG No data
Right 1184119555 22:42441142-42441164 TCCTGTTTGTCCTCCCAACATGG No data
1184119542_1184119550 -7 Left 1184119542 22:42441103-42441125 CCACCCAGCCTCCCCTTCTCCAG No data
Right 1184119550 22:42441119-42441141 TCTCCAGGCCAAGACATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184119542 Original CRISPR CTGGAGAAGGGGAGGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr