ID: 1184119643

View in Genome Browser
Species Human (GRCh38)
Location 22:42441454-42441476
Sequence CCTCGCCATGAGGGAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184119643_1184119653 6 Left 1184119643 22:42441454-42441476 CCTGGGCCTCCCTCATGGCGAGG No data
Right 1184119653 22:42441483-42441505 CTTCCTCGCAGGGACCCATTCGG No data
1184119643_1184119662 24 Left 1184119643 22:42441454-42441476 CCTGGGCCTCCCTCATGGCGAGG No data
Right 1184119662 22:42441501-42441523 TTCGGGGTGGCCCTTAGGAAGGG No data
1184119643_1184119649 -4 Left 1184119643 22:42441454-42441476 CCTGGGCCTCCCTCATGGCGAGG No data
Right 1184119649 22:42441473-42441495 GAGGCCCTTCCTTCCTCGCAGGG No data
1184119643_1184119648 -5 Left 1184119643 22:42441454-42441476 CCTGGGCCTCCCTCATGGCGAGG No data
Right 1184119648 22:42441472-42441494 CGAGGCCCTTCCTTCCTCGCAGG No data
1184119643_1184119657 11 Left 1184119643 22:42441454-42441476 CCTGGGCCTCCCTCATGGCGAGG No data
Right 1184119657 22:42441488-42441510 TCGCAGGGACCCATTCGGGGTGG No data
1184119643_1184119661 23 Left 1184119643 22:42441454-42441476 CCTGGGCCTCCCTCATGGCGAGG No data
Right 1184119661 22:42441500-42441522 ATTCGGGGTGGCCCTTAGGAAGG No data
1184119643_1184119654 7 Left 1184119643 22:42441454-42441476 CCTGGGCCTCCCTCATGGCGAGG No data
Right 1184119654 22:42441484-42441506 TTCCTCGCAGGGACCCATTCGGG No data
1184119643_1184119658 19 Left 1184119643 22:42441454-42441476 CCTGGGCCTCCCTCATGGCGAGG No data
Right 1184119658 22:42441496-42441518 ACCCATTCGGGGTGGCCCTTAGG No data
1184119643_1184119655 8 Left 1184119643 22:42441454-42441476 CCTGGGCCTCCCTCATGGCGAGG No data
Right 1184119655 22:42441485-42441507 TCCTCGCAGGGACCCATTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184119643 Original CRISPR CCTCGCCATGAGGGAGGCCC AGG (reversed) Intergenic
No off target data available for this crispr