ID: 1184119995

View in Genome Browser
Species Human (GRCh38)
Location 22:42443974-42443996
Sequence GTGAACTCCCAAACGACTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184119995_1184120003 6 Left 1184119995 22:42443974-42443996 CCGGGAGTCGTTTGGGAGTTCAC No data
Right 1184120003 22:42444003-42444025 CCCCAGGCATGGAGAAGGGGTGG No data
1184119995_1184119996 -10 Left 1184119995 22:42443974-42443996 CCGGGAGTCGTTTGGGAGTTCAC No data
Right 1184119996 22:42443987-42444009 GGGAGTTCACCTATCTCCCCAGG No data
1184119995_1184120001 3 Left 1184119995 22:42443974-42443996 CCGGGAGTCGTTTGGGAGTTCAC No data
Right 1184120001 22:42444000-42444022 TCTCCCCAGGCATGGAGAAGGGG No data
1184119995_1184120006 21 Left 1184119995 22:42443974-42443996 CCGGGAGTCGTTTGGGAGTTCAC No data
Right 1184120006 22:42444018-42444040 AGGGGTGGTGTTTCTGAATCAGG No data
1184119995_1184119999 1 Left 1184119995 22:42443974-42443996 CCGGGAGTCGTTTGGGAGTTCAC No data
Right 1184119999 22:42443998-42444020 TATCTCCCCAGGCATGGAGAAGG No data
1184119995_1184120000 2 Left 1184119995 22:42443974-42443996 CCGGGAGTCGTTTGGGAGTTCAC No data
Right 1184120000 22:42443999-42444021 ATCTCCCCAGGCATGGAGAAGGG No data
1184119995_1184119997 -5 Left 1184119995 22:42443974-42443996 CCGGGAGTCGTTTGGGAGTTCAC No data
Right 1184119997 22:42443992-42444014 TTCACCTATCTCCCCAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184119995 Original CRISPR GTGAACTCCCAAACGACTCC CGG (reversed) Intergenic
No off target data available for this crispr