ID: 1184123869

View in Genome Browser
Species Human (GRCh38)
Location 22:42472904-42472926
Sequence GCCATGGCCAGGGCGGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184123869_1184123877 -2 Left 1184123869 22:42472904-42472926 CCAGGAACCGCCCTGGCCATGGC No data
Right 1184123877 22:42472925-42472947 GCTGAGAGGCAGGAGCCAGGAGG No data
1184123869_1184123876 -5 Left 1184123869 22:42472904-42472926 CCAGGAACCGCCCTGGCCATGGC No data
Right 1184123876 22:42472922-42472944 ATGGCTGAGAGGCAGGAGCCAGG No data
1184123869_1184123878 -1 Left 1184123869 22:42472904-42472926 CCAGGAACCGCCCTGGCCATGGC No data
Right 1184123878 22:42472926-42472948 CTGAGAGGCAGGAGCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184123869 Original CRISPR GCCATGGCCAGGGCGGTTCC TGG (reversed) Intergenic
No off target data available for this crispr