ID: 1184124679

View in Genome Browser
Species Human (GRCh38)
Location 22:42478759-42478781
Sequence GACTCACGGTTCCACGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21420
Summary {0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184124679_1184124682 2 Left 1184124679 22:42478759-42478781 CCAGCCACGTGGAACCGTGAGTC 0: 11
1: 635
2: 4748
3: 7908
4: 8118
Right 1184124682 22:42478784-42478806 TTAAACTTCTTTTCCAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184124679 Original CRISPR GACTCACGGTTCCACGTGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr