ID: 1184124815

View in Genome Browser
Species Human (GRCh38)
Location 22:42479644-42479666
Sequence CCCTCATTCCGCCCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184124811_1184124815 -8 Left 1184124811 22:42479629-42479651 CCTCCTGTCTGTGGTCCCTCATT No data
Right 1184124815 22:42479644-42479666 CCCTCATTCCGCCCTGAGGCTGG No data
1184124807_1184124815 3 Left 1184124807 22:42479618-42479640 CCTTCTCCTGCCCTCCTGTCTGT No data
Right 1184124815 22:42479644-42479666 CCCTCATTCCGCCCTGAGGCTGG No data
1184124810_1184124815 -7 Left 1184124810 22:42479628-42479650 CCCTCCTGTCTGTGGTCCCTCAT No data
Right 1184124815 22:42479644-42479666 CCCTCATTCCGCCCTGAGGCTGG No data
1184124809_1184124815 -3 Left 1184124809 22:42479624-42479646 CCTGCCCTCCTGTCTGTGGTCCC No data
Right 1184124815 22:42479644-42479666 CCCTCATTCCGCCCTGAGGCTGG No data
1184124806_1184124815 29 Left 1184124806 22:42479592-42479614 CCTCAGAAGCAAAAGTTTCTCTC 0: 10
1: 62
2: 122
3: 108
4: 387
Right 1184124815 22:42479644-42479666 CCCTCATTCCGCCCTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184124815 Original CRISPR CCCTCATTCCGCCCTGAGGC TGG Intergenic
No off target data available for this crispr