ID: 1184127035

View in Genome Browser
Species Human (GRCh38)
Location 22:42494780-42494802
Sequence GCGTGCGCACACACATGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184127034_1184127035 10 Left 1184127034 22:42494747-42494769 CCTGCAGAGTAGTGTGTGTGTGT No data
Right 1184127035 22:42494780-42494802 GCGTGCGCACACACATGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184127035 Original CRISPR GCGTGCGCACACACATGCAT AGG Intergenic
No off target data available for this crispr