ID: 1184127966

View in Genome Browser
Species Human (GRCh38)
Location 22:42500953-42500975
Sequence CCGGGCGTGCGCGTGGGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184127957_1184127966 5 Left 1184127957 22:42500925-42500947 CCCAGGGTTCTAGGAGACCCTGA No data
Right 1184127966 22:42500953-42500975 CCGGGCGTGCGCGTGGGTGTCGG No data
1184127958_1184127966 4 Left 1184127958 22:42500926-42500948 CCAGGGTTCTAGGAGACCCTGAG No data
Right 1184127966 22:42500953-42500975 CCGGGCGTGCGCGTGGGTGTCGG No data
1184127950_1184127966 30 Left 1184127950 22:42500900-42500922 CCCGGGACACGGCCGCACGTGGC No data
Right 1184127966 22:42500953-42500975 CCGGGCGTGCGCGTGGGTGTCGG No data
1184127954_1184127966 18 Left 1184127954 22:42500912-42500934 CCGCACGTGGCCTCCCAGGGTTC No data
Right 1184127966 22:42500953-42500975 CCGGGCGTGCGCGTGGGTGTCGG No data
1184127956_1184127966 8 Left 1184127956 22:42500922-42500944 CCTCCCAGGGTTCTAGGAGACCC No data
Right 1184127966 22:42500953-42500975 CCGGGCGTGCGCGTGGGTGTCGG No data
1184127951_1184127966 29 Left 1184127951 22:42500901-42500923 CCGGGACACGGCCGCACGTGGCC No data
Right 1184127966 22:42500953-42500975 CCGGGCGTGCGCGTGGGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184127966 Original CRISPR CCGGGCGTGCGCGTGGGTGT CGG Intergenic
No off target data available for this crispr