ID: 1184129457

View in Genome Browser
Species Human (GRCh38)
Location 22:42509142-42509164
Sequence CCTGGCGCCCATGTCTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184129457_1184129467 -1 Left 1184129457 22:42509142-42509164 CCCAAGGAGACATGGGCGCCAGG No data
Right 1184129467 22:42509164-42509186 GAATCTCTGGGAGGGGGCCCTGG No data
1184129457_1184129465 -7 Left 1184129457 22:42509142-42509164 CCCAAGGAGACATGGGCGCCAGG No data
Right 1184129465 22:42509158-42509180 CGCCAGGAATCTCTGGGAGGGGG No data
1184129457_1184129468 6 Left 1184129457 22:42509142-42509164 CCCAAGGAGACATGGGCGCCAGG No data
Right 1184129468 22:42509171-42509193 TGGGAGGGGGCCCTGGCATGAGG No data
1184129457_1184129463 -9 Left 1184129457 22:42509142-42509164 CCCAAGGAGACATGGGCGCCAGG No data
Right 1184129463 22:42509156-42509178 GGCGCCAGGAATCTCTGGGAGGG No data
1184129457_1184129464 -8 Left 1184129457 22:42509142-42509164 CCCAAGGAGACATGGGCGCCAGG No data
Right 1184129464 22:42509157-42509179 GCGCCAGGAATCTCTGGGAGGGG No data
1184129457_1184129462 -10 Left 1184129457 22:42509142-42509164 CCCAAGGAGACATGGGCGCCAGG No data
Right 1184129462 22:42509155-42509177 GGGCGCCAGGAATCTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184129457 Original CRISPR CCTGGCGCCCATGTCTCCTT GGG (reversed) Intergenic
No off target data available for this crispr