ID: 1184131596

View in Genome Browser
Species Human (GRCh38)
Location 22:42519754-42519776
Sequence GCAGGAGGAAGTGCGCCGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 160}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184131596_1184131605 9 Left 1184131596 22:42519754-42519776 CCGCGCGGCGCACTTCCTCCTGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1184131605 22:42519786-42519808 TCTTGCCACCCGGGAGCGCGGGG 0: 2
1: 0
2: 0
3: 2
4: 72
1184131596_1184131599 -1 Left 1184131596 22:42519754-42519776 CCGCGCGGCGCACTTCCTCCTGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1184131599 22:42519776-42519798 CGCGCCACCATCTTGCCACCCGG 0: 2
1: 0
2: 1
3: 3
4: 68
1184131596_1184131604 8 Left 1184131596 22:42519754-42519776 CCGCGCGGCGCACTTCCTCCTGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1184131604 22:42519785-42519807 ATCTTGCCACCCGGGAGCGCGGG 0: 2
1: 0
2: 0
3: 5
4: 58
1184131596_1184131611 18 Left 1184131596 22:42519754-42519776 CCGCGCGGCGCACTTCCTCCTGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1184131611 22:42519795-42519817 CCGGGAGCGCGGGGGCCGCCGGG 0: 1
1: 1
2: 4
3: 70
4: 522
1184131596_1184131612 26 Left 1184131596 22:42519754-42519776 CCGCGCGGCGCACTTCCTCCTGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1184131612 22:42519803-42519825 GCGGGGGCCGCCGGGAGTTGCGG 0: 1
1: 1
2: 2
3: 20
4: 273
1184131596_1184131609 17 Left 1184131596 22:42519754-42519776 CCGCGCGGCGCACTTCCTCCTGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1184131609 22:42519794-42519816 CCCGGGAGCGCGGGGGCCGCCGG 0: 1
1: 1
2: 10
3: 65
4: 541
1184131596_1184131603 7 Left 1184131596 22:42519754-42519776 CCGCGCGGCGCACTTCCTCCTGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1184131603 22:42519784-42519806 CATCTTGCCACCCGGGAGCGCGG 0: 2
1: 0
2: 0
3: 7
4: 56
1184131596_1184131606 10 Left 1184131596 22:42519754-42519776 CCGCGCGGCGCACTTCCTCCTGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1184131606 22:42519787-42519809 CTTGCCACCCGGGAGCGCGGGGG 0: 2
1: 0
2: 2
3: 1
4: 177
1184131596_1184131600 0 Left 1184131596 22:42519754-42519776 CCGCGCGGCGCACTTCCTCCTGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1184131600 22:42519777-42519799 GCGCCACCATCTTGCCACCCGGG 0: 2
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184131596 Original CRISPR GCAGGAGGAAGTGCGCCGCG CGG (reversed) Exonic