ID: 1184133038

View in Genome Browser
Species Human (GRCh38)
Location 22:42529161-42529183
Sequence GAGTCATATTTTAGGTTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184133038_1184133043 12 Left 1184133038 22:42529161-42529183 CCATACAACCTAAAATATGACTC No data
Right 1184133043 22:42529196-42529218 TGCCCTATCTGTGCAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184133038 Original CRISPR GAGTCATATTTTAGGTTGTA TGG (reversed) Intergenic
No off target data available for this crispr