ID: 1184136756

View in Genome Browser
Species Human (GRCh38)
Location 22:42554269-42554291
Sequence CCGAGCGTGCGCGTGGGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184136740_1184136756 30 Left 1184136740 22:42554216-42554238 CCCGGGACACGGCCGCACGTGGC 0: 2
1: 0
2: 0
3: 10
4: 91
Right 1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG 0: 1
1: 1
2: 0
3: 3
4: 86
1184136747_1184136756 5 Left 1184136747 22:42554241-42554263 CCCAGGGTTCCAGGAGCCCCTGA 0: 1
1: 0
2: 4
3: 22
4: 311
Right 1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG 0: 1
1: 1
2: 0
3: 3
4: 86
1184136749_1184136756 -4 Left 1184136749 22:42554250-42554272 CCAGGAGCCCCTGAGTTAGCCGA 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG 0: 1
1: 1
2: 0
3: 3
4: 86
1184136748_1184136756 4 Left 1184136748 22:42554242-42554264 CCAGGGTTCCAGGAGCCCCTGAG 0: 1
1: 0
2: 5
3: 46
4: 396
Right 1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG 0: 1
1: 1
2: 0
3: 3
4: 86
1184136746_1184136756 8 Left 1184136746 22:42554238-42554260 CCTCCCAGGGTTCCAGGAGCCCC 0: 1
1: 0
2: 4
3: 45
4: 388
Right 1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG 0: 1
1: 1
2: 0
3: 3
4: 86
1184136744_1184136756 18 Left 1184136744 22:42554228-42554250 CCGCACGTGGCCTCCCAGGGTTC 0: 2
1: 0
2: 0
3: 45
4: 747
Right 1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG 0: 1
1: 1
2: 0
3: 3
4: 86
1184136741_1184136756 29 Left 1184136741 22:42554217-42554239 CCGGGACACGGCCGCACGTGGCC 0: 2
1: 0
2: 0
3: 7
4: 99
Right 1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG 0: 1
1: 1
2: 0
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184136756 Original CRISPR CCGAGCGTGCGCGTGGGTGT CGG Intronic
900131581 1:1089523-1089545 CCGAGGCTGGGCGTGGGGGTTGG - Intronic
900223787 1:1523430-1523452 CCGAGCGTGTGTGTGCGCGTTGG + Intronic
906114615 1:43348555-43348577 CCGAGGGTGTACCTGGGTGTTGG + Intronic
910760933 1:90730439-90730461 GCGTGCGCGCGCCTGGGTGTGGG - Intergenic
912910922 1:113758930-113758952 GCGAGCGTGTTCGTGGGTGCGGG + Intronic
914827732 1:151147228-151147250 CCTAGCATGCGCGTGGGGGCTGG + Intergenic
914869109 1:151458760-151458782 CCGAGCGTGCGTGTGGACGTCGG + Intronic
1062864299 10:837639-837661 CTGCCCGTGCACGTGGGTGTTGG - Intronic
1064118394 10:12598285-12598307 CAGAGCGTGCGATTAGGTGTGGG + Intronic
1073577989 10:104641216-104641238 GCGAGCGAGCGTGTGTGTGTAGG - Exonic
1077124337 11:925813-925835 GCGTGCGTGCGCGTGCGTGCTGG + Intronic
1077338850 11:2017183-2017205 CAGAGCGTGGGCCTGGGAGTAGG - Intergenic
1080139661 11:28901043-28901065 CCTAGTGTGGGCGAGGGTGTTGG + Intergenic
1083879495 11:65540995-65541017 CTGAGCGCGCGCGTGGGCTTAGG + Intronic
1085280097 11:75324597-75324619 GGGAGTGTGCGTGTGGGTGTGGG + Intronic
1202821834 11_KI270721v1_random:72365-72387 CAGAGCGTGGGCCTGGGAGTAGG - Intergenic
1097895863 12:64824581-64824603 GCGAGCGAGCGCGTGGGAGACGG - Exonic
1104676241 12:130714361-130714383 CCGGGGGTGGGCGTGGGTGGTGG - Intronic
1105847883 13:24308616-24308638 CCGAGTGTACGGGTGGGTGCGGG - Intronic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1111183990 13:84705235-84705257 GCGCGCGCGCGCGTGCGTGTTGG + Intergenic
1118109213 14:62697098-62697120 GCGTGTGTGGGCGTGGGTGTGGG - Intergenic
1122327938 14:100893823-100893845 CCGGGTGTGAGGGTGGGTGTAGG - Intergenic
1124637399 15:31373834-31373856 CAGAGTGTGTGCGTGCGTGTGGG + Exonic
1125270537 15:37934103-37934125 GCGCGCGCGCGCGTGTGTGTAGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1132724529 16:1333170-1333192 CAGACCGTCCGCGTGGGCGTGGG + Intergenic
1132785475 16:1654933-1654955 CAGGGCGTGGGCGTGGGTGCTGG - Intronic
1141538539 16:84700198-84700220 CGGAGCGAGCGTGTGGGAGTGGG + Intronic
1143104548 17:4522445-4522467 CAGTGAGTGCGCGTGGGTGGTGG - Intronic
1143148002 17:4789215-4789237 CCGAGCGGGCGCCTGGGTAGAGG - Exonic
1143591653 17:7888706-7888728 CTGAGAGTGTGTGTGGGTGTGGG + Intronic
1144742361 17:17591109-17591131 CTGAGCGTGGGCGAGGGTGAAGG - Intronic
1152353796 17:79797355-79797377 CCGAGCGCGCGAGTGGGAGGGGG + Intronic
1152737810 17:82005833-82005855 CCCAGCGTGACCGTGTGTGTGGG + Intronic
1160024772 18:75208734-75208756 CCGAGCGCGCGCCGGAGTGTGGG + Intronic
1161447416 19:4326507-4326529 CCGAGAATCCGGGTGGGTGTTGG - Intronic
1163502972 19:17687243-17687265 CAGAGCGTGGGCCTGGGCGTGGG + Intronic
1165777551 19:38413529-38413551 AAGAGCCTGCGAGTGGGTGTGGG - Intronic
1166042909 19:40214026-40214048 CTGGGCGAGGGCGTGGGTGTGGG - Exonic
1167412990 19:49355965-49355987 CAGAGCCTGCCCGTGGGGGTGGG + Exonic
928549708 2:32358019-32358041 CCCAGCGTGGGGGTGGGGGTGGG + Intronic
930374064 2:50541704-50541726 CAGAGTGTGTGTGTGGGTGTGGG - Intronic
931201935 2:60106059-60106081 CTGGGCGTGGGCGTGGGTGGAGG - Intergenic
931869059 2:66440040-66440062 GCGCGCGCGCGCGTGTGTGTTGG - Intronic
932231401 2:70087043-70087065 GAGCGCGTGCGCGAGGGTGTGGG - Intergenic
932809295 2:74810835-74810857 CTGAGCATGTGTGTGGGTGTTGG + Intergenic
934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG + Intronic
942346197 2:175005180-175005202 CGGAGCGTGCGCGCGGGAGGAGG + Exonic
946365074 2:219243999-219244021 CCGAGGGTGGGGGTGGGGGTGGG + Intronic
946865898 2:224040278-224040300 CAGAGTGTGCACGTGTGTGTTGG + Intergenic
1170758606 20:19228494-19228516 CCGGGCGTGGGCGTGGTGGTGGG + Intronic
1173475931 20:43359742-43359764 CTGAGCAGGGGCGTGGGTGTGGG + Intergenic
1179783780 21:43718728-43718750 ACGAGAGTGCGCGCGGGCGTGGG - Intergenic
1181057629 22:20267663-20267685 CCGAGGGTGGGTGGGGGTGTCGG - Intronic
1184127966 22:42500953-42500975 CCGGGCGTGCGCGTGGGTGTCGG + Intergenic
1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG + Intronic
959683101 3:109118132-109118154 GTGAGCGTGGGCGTGGGAGTGGG - Exonic
959683103 3:109118138-109118160 CTGCGCGTGAGCGTGGGCGTGGG - Exonic
966447893 3:180024007-180024029 CCAAGTGTGTGCCTGGGTGTGGG + Intronic
967889130 3:194352493-194352515 GAGTGCGTGCGTGTGGGTGTGGG + Intergenic
968578808 4:1380244-1380266 CCGAGGGCGGGGGTGGGTGTGGG + Intronic
969115868 4:4870425-4870447 CCGAGGGTGTGTGTGGGTGAGGG + Intergenic
969453033 4:7285797-7285819 CCGAGGGTGCGGGAGTGTGTGGG + Intronic
970407666 4:15778842-15778864 CCGAGCGTGCCCGCGGGAGGCGG + Intronic
979608773 4:122668609-122668631 CTGAGTGTGTGCGTGCGTGTTGG + Intergenic
985190048 4:187363067-187363089 CCGGGCGTCAGCGTGTGTGTAGG - Intergenic
985680970 5:1255454-1255476 CAGACGGTGCTCGTGGGTGTGGG + Intronic
988577902 5:32444489-32444511 CCGGGCGTGCGAGTGAGTGAGGG - Intronic
991680692 5:69136625-69136647 CCCAGTGTACGCGTGTGTGTGGG - Intergenic
994173122 5:96680204-96680226 CCAGGCGTGGTCGTGGGTGTGGG + Intronic
997237157 5:132279336-132279358 GCGCGCGCGCGCGTGGGTGTCGG - Intronic
998083356 5:139294468-139294490 CCGCGCGCGCGCGCGCGTGTGGG - Intronic
999330752 5:150672015-150672037 GCGCGCGTGCGCGTGTGTGTTGG - Intronic
1003942658 6:11044334-11044356 CCGGGCGTGGGTGTGGGTGGGGG - Intergenic
1008595311 6:53035946-53035968 CCCAACAAGCGCGTGGGTGTGGG + Intronic
1008936489 6:56997955-56997977 CGGAGCGTGTGTGTGGGGGTGGG + Intronic
1013836422 6:114341593-114341615 GCGCGCGCGCGCGTGTGTGTTGG + Intronic
1019271228 7:150194-150216 CCGAGTGTGCACGTGGGCCTCGG - Intergenic
1023735921 7:43235766-43235788 CTGAGTGTGGGCATGGGTGTGGG + Intronic
1033120847 7:138665078-138665100 TCGAGCGTGGGGGTGGGGGTAGG - Intronic
1035252513 7:157606340-157606362 CCCAGCGTGGGGGTGGGGGTGGG + Intronic
1042169969 8:65981640-65981662 ACAAGCGTGGGTGTGGGTGTGGG - Intergenic
1049405643 8:142450802-142450824 CCAGGCGTTCGCGTGGGGGTGGG - Intronic
1049433622 8:142576374-142576396 CAGAGCCTGCCCGTGGGTGCAGG + Intergenic
1049766614 8:144358137-144358159 TCGGGCGTGGGCGTGGGTGCCGG + Exonic
1057146731 9:92764068-92764090 CCGAGGGTGGGCCTGGGTCTGGG - Intronic
1061553391 9:131350744-131350766 CCGGGCGTGGGCGTGGTAGTGGG - Intergenic
1062534955 9:137017371-137017393 CCGGGCGTGCGGGTGGATGACGG - Intronic
1192624461 X:72713701-72713723 CCGTGCGTGCGTGCGTGTGTGGG - Intronic
1197735083 X:129844189-129844211 GCGCGCGCGCGCGTGTGTGTAGG - Intergenic