ID: 1184138076

View in Genome Browser
Species Human (GRCh38)
Location 22:42561242-42561264
Sequence CTGGAGGGAGATGGTGTCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184138063_1184138076 29 Left 1184138063 22:42561190-42561212 CCTGCTTCAGAGCAGTGGTCCAG 0: 1
1: 0
2: 2
3: 17
4: 248
Right 1184138076 22:42561242-42561264 CTGGAGGGAGATGGTGTCGTCGG 0: 1
1: 0
2: 1
3: 16
4: 236
1184138067_1184138076 10 Left 1184138067 22:42561209-42561231 CCAGGAAGCAGCTCTCCCAGGGT 0: 1
1: 0
2: 5
3: 30
4: 266
Right 1184138076 22:42561242-42561264 CTGGAGGGAGATGGTGTCGTCGG 0: 1
1: 0
2: 1
3: 16
4: 236
1184138071_1184138076 -5 Left 1184138071 22:42561224-42561246 CCCAGGGTGAGGGAACAGCTGGA 0: 1
1: 0
2: 3
3: 28
4: 292
Right 1184138076 22:42561242-42561264 CTGGAGGGAGATGGTGTCGTCGG 0: 1
1: 0
2: 1
3: 16
4: 236
1184138072_1184138076 -6 Left 1184138072 22:42561225-42561247 CCAGGGTGAGGGAACAGCTGGAG 0: 1
1: 0
2: 10
3: 61
4: 552
Right 1184138076 22:42561242-42561264 CTGGAGGGAGATGGTGTCGTCGG 0: 1
1: 0
2: 1
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184138076 Original CRISPR CTGGAGGGAGATGGTGTCGT CGG Intronic
900183674 1:1323322-1323344 CTGGAGGGACATGGTGTTGGTGG - Intronic
900682295 1:3923769-3923791 CTGGAGGGTGCTGGTGCCGAGGG - Intergenic
901019433 1:6248427-6248449 ATGGAGGGAGATGATGTGGTGGG + Exonic
901470166 1:9450524-9450546 CTGGAAGGAGATGATGTCTACGG - Intergenic
901486321 1:9565162-9565184 CTGGAGGTAGATGGTGGTGATGG + Intronic
904453536 1:30632402-30632424 GTGGAGGGAGATGGTGACAGTGG - Intergenic
906812698 1:48845312-48845334 CTGGAGGTAGATTGAGTCCTAGG - Intronic
906825240 1:48972241-48972263 CTGAAGGGAGATGGTCAAGTTGG + Intronic
912371893 1:109179991-109180013 CTGGAGGCAGAGGCTGTGGTAGG + Intronic
912504786 1:110149139-110149161 CTAGAGGGAGACGCTATCGTTGG - Intergenic
913350151 1:117849089-117849111 TTGGAAGCAGATGGTGTCATTGG - Intergenic
915285599 1:154850113-154850135 GTGGAGGGAGATGGTGCAGAGGG - Intronic
915291621 1:154888045-154888067 CTGGAGGGAGTTGGTGTGGCTGG - Intergenic
916782601 1:168051952-168051974 CTGGAGGCAGAGGTTGTAGTGGG - Intronic
916911982 1:169360582-169360604 CAGGAGGGAGATAGTGTGGCTGG - Intronic
917889077 1:179418668-179418690 CGGGAGGGAGGTGGTGGTGTCGG - Intronic
918652377 1:186981648-186981670 CTGGAGATAGATGGTGGGGTTGG - Intronic
920070049 1:203296290-203296312 CTAGAGGGAGAAGGTGTGGGAGG + Intergenic
922855346 1:228770316-228770338 CTGGAGGGAGATGTGGTGTTGGG + Intergenic
923786322 1:237072035-237072057 CTGGGGGAAGAGGGTGTCCTGGG + Intronic
1064161711 10:12952207-12952229 CAGGAGGGAGAAGGTTTTGTTGG + Intronic
1067747890 10:48950125-48950147 CTGGAGGCAGATGGTGGCGATGG - Intronic
1068730762 10:60355721-60355743 CTGGAGGGAGATGTTGGGGAAGG - Intronic
1069651369 10:70052511-70052533 TTGGTGGGAGAAGGTGGCGTGGG - Intergenic
1069919539 10:71808073-71808095 CTGGGGGGAGATGGGGTCTGTGG + Intronic
1072626586 10:97116296-97116318 CTGGAGGGAGGAGGTGAAGTGGG - Intronic
1073253430 10:102135804-102135826 CTGGAGGGAGCAGGTTTGGTGGG + Intronic
1073297367 10:102449428-102449450 TTGGAGGGAGATGGTGAAGAGGG + Intergenic
1073494302 10:103877765-103877787 CTGAAGGGAGATGGTGTCTGTGG - Intergenic
1075684279 10:124353225-124353247 CGGGAGGGAGCTGGGGTCGGGGG - Intergenic
1075861276 10:125678983-125679005 CTGGAGGGAGGGGTTGTCTTTGG + Intronic
1077148075 11:1054729-1054751 CTGGATGGAGCTGGTTTCGAGGG - Intergenic
1078250114 11:9609815-9609837 CTGGAGGCAGATGTTGCAGTGGG + Intergenic
1079060268 11:17242294-17242316 CTGGAGGGAGAGGTTGCAGTGGG + Intronic
1079083571 11:17430146-17430168 CTGGAGTGAGAAGATGTCCTTGG - Intronic
1079312851 11:19381645-19381667 CTGAAGCGAGCTGGTGTCCTGGG + Intronic
1080590162 11:33716398-33716420 CTGGGGGGAGCTGGTGTAGAAGG + Intronic
1081704148 11:45170939-45170961 ATGGAGGGGGATGGGGTGGTTGG - Intronic
1083222104 11:61259165-61259187 CTCGAGGGTGATGCTGTCGGGGG + Exonic
1083326605 11:61876242-61876264 CAGGTGGGGGATGGTGCCGTGGG - Intronic
1084218285 11:67663341-67663363 GTGGTGGGAGAAGGTGTCGAAGG + Exonic
1084270717 11:68027785-68027807 ATGGTGGGAGAAGGTGTCGAAGG - Exonic
1084593567 11:70104452-70104474 CTGGAGGGGGATGGGGTGGCGGG - Intronic
1085396148 11:76208135-76208157 CTGCAGGGAGACGGGGTCCTCGG - Intronic
1085409300 11:76281981-76282003 CTGCAGGGAGATGGGGAGGTGGG - Intergenic
1085626713 11:78079531-78079553 CTGGGAGGAGAAGGGGTCGTAGG - Intronic
1086417837 11:86606736-86606758 GTGGAGGGATGTGGTGTCTTTGG + Intronic
1087009377 11:93499039-93499061 CAGGAAGGAGAAAGTGTCGTGGG + Intronic
1087936185 11:104036860-104036882 CTGGAGAGAGAAGGTGACCTCGG - Exonic
1088288012 11:108207390-108207412 CAGGAGGCAGATGGTCTCCTAGG - Intronic
1089553422 11:119299777-119299799 CAGCAGGGAGATGGTGTGCTAGG - Exonic
1091626104 12:2122091-2122113 CTGGAGGCAGAGGGGCTCGTAGG + Intronic
1091628157 12:2138492-2138514 CTTGTGGGAGAAGGTGTCGAAGG + Intronic
1091691029 12:2597689-2597711 CTGGAGGGAGGAGCTGTGGTGGG - Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1095439715 12:42228234-42228256 CTGGAGGGAGGTGGGGGTGTCGG + Intronic
1100365290 12:93914938-93914960 CTGGAGGTAGATGGTGAGGGCGG + Intergenic
1100569086 12:95829360-95829382 CTGGAGGCAGATGGTGGTGATGG + Intergenic
1101079769 12:101171019-101171041 CAGGAGCAGGATGGTGTCGTGGG + Intronic
1101204333 12:102470353-102470375 CAGGAGGGAGATGGTCTTGAAGG + Intronic
1101953719 12:109196162-109196184 CTGGAGGGAGATGTAGTGCTGGG + Intronic
1103038089 12:117672696-117672718 CTGGAGGCAGAGGTTGTGGTGGG - Intronic
1103173628 12:118843552-118843574 CAGGAGGGAGATAGTGGGGTAGG + Intergenic
1103297156 12:119897483-119897505 CTGGAGGGAGATATTCTCTTTGG - Intergenic
1104085121 12:125467251-125467273 ATGGAGAGAGATGGTGGGGTTGG + Intronic
1104636417 12:130440366-130440388 TTGGAGGAAGAAGGTGTAGTTGG - Intronic
1105795614 13:23849164-23849186 GTGGATGGAGATGGTGCAGTTGG - Intronic
1107450347 13:40503048-40503070 ATTGAGGGTGATGGTGACGTGGG - Intergenic
1108586765 13:51876621-51876643 CTGAAGGGAGATGATGTTTTTGG + Intergenic
1112324968 13:98438008-98438030 CTGGAAGTAGATGGTGGCGATGG + Intronic
1112546216 13:100373660-100373682 CTGGAGGTAGATGGTGGTGATGG + Intronic
1112562904 13:100529577-100529599 CTGAAGGGAAATGGAGTCCTTGG - Intronic
1113766092 13:112881950-112881972 CTGGAAGGAGAAGGTGTCCACGG + Exonic
1117079130 14:52133294-52133316 CTGGAGCCAGATGGTGAAGTGGG - Intergenic
1119136351 14:72224342-72224364 CTGGAGGGAGAGGTTCTCGTGGG + Intronic
1119404245 14:74386797-74386819 CTGTAGGGTGATGGTGGCATAGG + Intergenic
1124200790 15:27677164-27677186 CTGGAGGGAGCTGGAGTGGTGGG - Intergenic
1124472111 15:29996905-29996927 CTGGCCGGAGATGCTGTCCTGGG + Intergenic
1124679474 15:31717937-31717959 CTGGTGAGAGATGGTATCCTTGG + Intronic
1127968580 15:63942059-63942081 GTGGTGTGAGATGGTGTCCTGGG - Intronic
1128138862 15:65284747-65284769 CTGGACGTAGCTGGTGTCATTGG - Intronic
1130817049 15:87447798-87447820 CTGCAGGGAGTTGGAGTGGTGGG - Intergenic
1132652901 16:1029482-1029504 CTGGAGGGAGGTGGTGGCCCCGG - Intergenic
1132803179 16:1763982-1764004 CTGGAGGCAGGTGGGGGCGTGGG - Intronic
1133916819 16:10116579-10116601 CTGGGGGGACATGGTTTAGTTGG + Intronic
1134454420 16:14383997-14384019 CTGGAGGTGGATGGTGGCGAGGG + Intergenic
1135003727 16:18800766-18800788 CTGCAGTGAGATGGTATCATAGG - Intronic
1135406392 16:22201114-22201136 CTGGAGGCAGATGTTGCAGTAGG + Intergenic
1139327485 16:66163685-66163707 TTGGAGGGAGAGGGAGTGGTAGG + Intergenic
1139727920 16:68916848-68916870 CTGGTGGGAGATGGTGACAATGG - Intronic
1142197412 16:88745204-88745226 CAGGAGGGAGTTGGAGTCGGGGG - Intronic
1144041243 17:11413165-11413187 CCGGAAGGAGATAGTGTCCTGGG - Intronic
1145989714 17:29071663-29071685 ATGGAGGGAGATGCTCTCTTTGG - Intergenic
1146481387 17:33207789-33207811 CTGAAGGGTGATGGAGTCTTTGG - Intronic
1148623662 17:49053232-49053254 CTGGAGGGGGATGCTCTAGTTGG + Exonic
1149909173 17:60552088-60552110 CTGGAGGGAGGTGGGGGTGTCGG + Intergenic
1150710009 17:67523032-67523054 CTGGAGGTAGATGGTGATGATGG - Intronic
1152069484 17:78127871-78127893 CTGGAGGGAGGGGGTGGTGTGGG - Intronic
1152200876 17:78945219-78945241 CTCGAGGGAGGTGGTGTCGGGGG - Intergenic
1152234814 17:79133091-79133113 CTGGAGGCAGAAGGTCTCCTTGG - Intronic
1152722749 17:81930927-81930949 AAGGAGGGAGATGGTGCCGGGGG - Intergenic
1155280095 18:24230318-24230340 CTGGAGAGAGATGGTGGTGATGG + Intronic
1155307860 18:24496687-24496709 CTGGAGGTAGATGGTGGTGATGG - Intergenic
1158318538 18:56238143-56238165 CTGGAGGATGATGGGGTCGGAGG + Intergenic
1159948890 18:74464459-74464481 CTGGTGGGAGATGTTGATGTGGG - Intergenic
1160841114 19:1147421-1147443 CTGGAGGGAGATGGGGGGGGGGG + Intronic
1161390626 19:4018632-4018654 CAAGGGGGAGATGGTTTCGTGGG - Intronic
1161530429 19:4785771-4785793 CGGGAGGGAGAGGTTGTGGTGGG - Intergenic
1161756157 19:6135739-6135761 CTGGACGGAGAGGGTGACGGGGG + Exonic
1162944117 19:14031980-14032002 CTGGAGGGAGCTCGTGTCCCGGG + Intronic
1163413421 19:17171262-17171284 CAGGAGGGAAATGATGTTGTTGG - Intronic
1163502365 19:17684211-17684233 CAGGAGGGAGATGGTGCTCTGGG - Intronic
1164435841 19:28228594-28228616 CTGGAGGGAGAGGCTGTGGATGG - Intergenic
1166256209 19:41606646-41606668 CTGGAGGGTGGTGGTGTCCAGGG - Intronic
1166949444 19:46416678-46416700 CTGCAGGGAGATGGTGGGGGTGG + Intergenic
1167089554 19:47334128-47334150 CTGGAAGGAGCTGATGTTGTGGG + Intronic
1168492102 19:56819535-56819557 GAGGAGGGAGATGGTGCTGTGGG + Intronic
1168499331 19:56880169-56880191 CTGGAGGCAGATGGTGATGATGG + Intergenic
925285680 2:2714211-2714233 CTGGTGGGAGCTGGAGTCATGGG + Intergenic
927134478 2:20086741-20086763 CTGGAAGGAGATGTTTTCTTTGG - Intergenic
927497018 2:23557774-23557796 CTGGAAGGAGATGGCTTCTTTGG + Intronic
927863709 2:26575946-26575968 CTTGAGGGTGGTGGTGCCGTAGG - Exonic
927989143 2:27435177-27435199 CTGGATGAAGATGGTGTCACAGG - Exonic
928239091 2:29571074-29571096 CTGGAGGGAGATAGTGGAGGGGG + Intronic
928441865 2:31298805-31298827 CTGGAGGGAGATGGGATGGTGGG + Intergenic
930951290 2:57146615-57146637 CTGGCGGGAGTGGCTGTCGTTGG - Intergenic
932674046 2:73762810-73762832 GAGGAGGGAGATGGTGTCTCTGG + Exonic
934846418 2:97663861-97663883 CTGGTTGGCGATGATGTCGTAGG + Exonic
934939072 2:98486777-98486799 CTGGAGGGAGCTGATGTGGGAGG + Intronic
936750779 2:115639007-115639029 CTGTAGGAAGATGTTGTCTTTGG + Intronic
939957625 2:148540048-148540070 CTGAAGGGAGATGTGGCCGTGGG - Intergenic
940339674 2:152567126-152567148 CAGGAGTGAGATGGTTTCCTTGG + Intronic
941092216 2:161190865-161190887 CTGGAGGTAGATGGTGGTGATGG + Intronic
941311920 2:163943842-163943864 CTCAAGGGAGATGGGGTCGGTGG - Intergenic
946230444 2:218287835-218287857 CAGGAGGGAGAGGCTGTCCTGGG + Intronic
946744423 2:222831484-222831506 CTGGAAAGAGATGGTGACCTTGG + Intergenic
1168846996 20:952067-952089 CAGGAGGGAGATGGGGTCACAGG + Intergenic
1168978527 20:1985926-1985948 CAGGAGTTAGATGGTGTGGTAGG - Intronic
1170493729 20:16904162-16904184 CTGGAGAGAGAGGGTGAGGTGGG + Intergenic
1172422894 20:34832390-34832412 CTGGAGGTAGATGGTGGTGATGG + Intergenic
1173234212 20:41228994-41229016 CTGGAGGCAGATGGTGATGATGG - Intronic
1173338188 20:42130300-42130322 ATGGAGGGAGGTGGTGGAGTTGG + Intronic
1173815022 20:45981725-45981747 TTGGAGGGGGATGGGGTAGTGGG + Intergenic
1175977023 20:62716128-62716150 CTGGAGGTGGATGGTGGCGACGG - Intronic
1176034945 20:63031639-63031661 CTGGGGAGGGACGGTGTCGTTGG + Intergenic
1176245598 20:64095123-64095145 GTGGGGGGAGATGGTGTGGGGGG + Intronic
1176358048 21:5969146-5969168 CTGGCTGGGGATGGTGCCGTGGG + Intergenic
1177905234 21:26966066-26966088 CTGGAGCGAGATGGTTCGGTGGG - Exonic
1178495296 21:33081138-33081160 CTGGAGTGAGCTGTTGTCCTGGG + Intergenic
1179765470 21:43569405-43569427 CTGGCTGGGGATGGTGCCGTGGG - Intronic
1180182245 21:46123236-46123258 CTGGTGGGGGATGCTGTAGTGGG - Intronic
1181062907 22:20290519-20290541 CTGGAGGAAGATGGGGGCATGGG + Intergenic
1181763152 22:25071965-25071987 CTCAAGGGATATGGTCTCGTTGG + Intronic
1182278338 22:29204393-29204415 CTGGAGGGAGAGGGAGCCCTTGG + Intergenic
1182361312 22:29748058-29748080 CAGGAGGGAGAGGGTGTGGCTGG - Intronic
1182437310 22:30338963-30338985 CTGGAGGGTGATGTTGGCCTGGG + Exonic
1183378416 22:37478583-37478605 CTGGAGGGAGAGGGTGCCCCAGG + Intronic
1184138076 22:42561242-42561264 CTGGAGGGAGATGGTGTCGTCGG + Intronic
1184281415 22:43439784-43439806 CTGGAGGGAAATGGTGCTGCTGG - Intronic
949854102 3:8444235-8444257 CTGGTGGGAGTTGGGGACGTGGG - Intergenic
950097072 3:10336641-10336663 GTGGAGGTAGAGGGTGTGGTGGG + Intronic
951381515 3:21989173-21989195 ATTGAGGGAGATGGGGTCGGAGG - Intronic
951728076 3:25782426-25782448 CTGAAGGGACATGGTGTGGGGGG - Intronic
953477420 3:43217586-43217608 CTGGAGGAAGATGGTGGGATTGG - Intergenic
953784125 3:45897601-45897623 CTGGAAGGAGATGGATTCCTGGG - Intronic
954700321 3:52447503-52447525 CTGGTGGGAGATGGTGAGCTGGG + Intergenic
955777167 3:62446268-62446290 CCAGAGGGAGATGGTGTCTGCGG + Intronic
956710220 3:72032574-72032596 CTGGTGGGAGGTGGTGTGGTGGG + Intergenic
961405114 3:126672832-126672854 CTTGAAGGTGATGGTCTCGTAGG + Intergenic
961655437 3:128439100-128439122 ATGAAGGGAGATGGTGACGAGGG - Intergenic
962142515 3:132805265-132805287 CTGGAGGGAGGGGGTGTAGGAGG + Intergenic
962971038 3:140402282-140402304 CTGTTTGGAGATGGTGTGGTGGG + Intronic
966283980 3:178271191-178271213 CTGGAGGGAGGTGTTGCCATTGG + Intergenic
966933105 3:184688494-184688516 CTGGTGGGACATGGGGTCGGGGG + Intergenic
969460098 4:7324447-7324469 CTGGGCGGAGATGGTGACGCCGG - Intronic
969705240 4:8788192-8788214 CTGCTGGGAAATGGTGTGGTGGG + Intergenic
969827326 4:9767846-9767868 CTGAAGGGAGATGGGGCTGTAGG - Intergenic
969987339 4:11225694-11225716 CTGTAGGGAGATTGTGTCCTGGG - Intergenic
977150579 4:93506709-93506731 CTGGATGGAGAGGGTGCCATAGG - Intronic
982698665 4:158633613-158633635 CTGGAGGTAGATGGTGGTGGTGG - Intronic
983613988 4:169680617-169680639 CTGGGGGCAGATGGTCTTGTGGG + Intronic
985896799 5:2753541-2753563 GTGGAGGGAGAGGTGGTCGTGGG - Intronic
989347149 5:40441833-40441855 CTGAAAGGAGGTGGTGTGGTTGG - Intergenic
989445388 5:41522581-41522603 CAGGAGGGAGAGAGTGTGGTGGG + Intergenic
990585545 5:57207723-57207745 CAGGAGGGAGATGGAGTGGGAGG + Intronic
992614476 5:78535484-78535506 CTGGTGGGAGAGGGGGTCCTAGG - Intronic
996069958 5:119122264-119122286 CGGGAGGGAGGTGGGGTGGTCGG - Intronic
997205628 5:132047507-132047529 CTGGAGGTAGATGGTGGTGATGG - Intergenic
998146431 5:139731691-139731713 CTGGAGGGACATGGAGACCTGGG + Intergenic
1000187675 5:158876355-158876377 CTAGAGGGAAAAGGGGTCGTGGG - Intronic
1000207399 5:159075582-159075604 TTGGATGGAGATGGTGTAGTGGG - Intronic
1001083750 5:168685687-168685709 CTGCAGGGAGATGTTGGCCTGGG + Exonic
1001742966 5:174068862-174068884 GTGGAAGGTGCTGGTGTCGTGGG + Intronic
1002043683 5:176530803-176530825 CTGGAGGGAGATGGCGTGGGGGG - Intronic
1002701871 5:181130350-181130372 CTGGAGGCTGAGGGTGCCGTGGG - Intergenic
1002703926 5:181147796-181147818 CTGGAGGCTGAGGGTGCCGTGGG + Intergenic
1003314908 6:5003626-5003648 CTGGAGGGAGCTGTTGTCAGGGG - Intronic
1003503407 6:6721102-6721124 CTGGAGGCAGATGGTGTTGATGG + Intergenic
1003631081 6:7788154-7788176 CTGGAAGAAGATGGAGTCCTTGG + Intronic
1004166484 6:13261225-13261247 CTGGAGGAAGAGGCTGGCGTAGG + Intronic
1006366219 6:33617355-33617377 CTGGAGGGAGAGAATGTAGTTGG + Intergenic
1007108823 6:39301361-39301383 CTGGAGAGAGAGGCTGTCTTGGG - Intronic
1007663752 6:43502443-43502465 CTTGAGGGAGATGGTGGGATGGG + Intronic
1007970215 6:46044394-46044416 GTGGAGGGAAATGGTGGCTTTGG + Intronic
1012939959 6:105404903-105404925 CTGGAGTGAGATGGAGTGGGAGG + Intergenic
1013195447 6:107841056-107841078 CAGGAGGGAGATGGTGTTTGGGG - Intergenic
1013676866 6:112474349-112474371 CTCGAGGGATGTGGTGTCCTGGG - Intergenic
1014594328 6:123314292-123314314 CTGGTGTGAGATGGTCTCATTGG - Intronic
1016998441 6:149977432-149977454 CAGGAGGGGGATGGTGTGGCTGG - Intergenic
1017365623 6:153633268-153633290 CTGCAGGTAGTTGGTGTGGTAGG - Intergenic
1017406948 6:154129830-154129852 CTGGGGGGGGAGGGTGTCGGTGG - Intronic
1019075364 6:169382935-169382957 CTGGAGGAAGAGGGTGTCCAAGG + Intergenic
1019521209 7:1461318-1461340 CTGGAGGGACATGGTGTGTGAGG - Intergenic
1019779223 7:2929808-2929830 CTGGAGGGAGAGAGGGTGGTGGG + Intronic
1019779248 7:2929888-2929910 CTGGAGGGAGAGTGGGTGGTGGG + Intronic
1019954684 7:4404277-4404299 CAGTAGGGAGATGGAGTTGTGGG + Intergenic
1020007525 7:4790398-4790420 CTGGATGGGGATGGGGTCATAGG + Intronic
1021872572 7:25019172-25019194 CGGGAGGGAGGTGGGGTGGTCGG + Intergenic
1022031986 7:26500201-26500223 CTGGAGGTGGATGGTGTTGATGG - Intergenic
1025069665 7:55887570-55887592 CGGGAGGGAGAAGGTGCCGAGGG - Intronic
1029465563 7:100722610-100722632 CAGGAGGGAGAGGGTGACATGGG + Intronic
1029724435 7:102392903-102392925 CTGGAGGGACATGGGCTCCTAGG - Intronic
1032394290 7:131578158-131578180 ATGGTGGGAGATGGTGTTGCTGG - Intergenic
1033951971 7:146796191-146796213 AGGGAGGGAGATGGTGTCACAGG + Intronic
1034491971 7:151397682-151397704 CGGGAGGAAGAGGGTGTAGTGGG + Intronic
1035020441 7:155797309-155797331 CTGGAGGGAGCTGGGGTCCCAGG - Intergenic
1036453380 8:8888904-8888926 CTGGTGGGAGATGTTGACGTTGG + Intronic
1036661851 8:10714181-10714203 CAGGATGGAGATGGTGTCGTGGG + Intergenic
1036666389 8:10745445-10745467 CTGGAGGTAGATGGTGGTGATGG - Intronic
1037217901 8:16480104-16480126 ATGAAGGGAGATGGTGACATTGG - Intronic
1041494760 8:58473310-58473332 CTGGAGGTAGATGGTGGTGATGG - Intergenic
1041726196 8:61019830-61019852 CTGGAGTGGGATGATGTGGTTGG + Intergenic
1041917164 8:63149317-63149339 CTGGAAGGAGATATTTTCGTTGG + Intergenic
1048583982 8:135755757-135755779 CAGGAGGGAGGTGGTGTGGAGGG + Intergenic
1049665058 8:143839342-143839364 CTGAATGAAGATGGTGTCGCTGG + Exonic
1055907802 9:81314338-81314360 TTGGAGGGAGGTGGGGTCTTTGG - Intergenic
1058782684 9:108354045-108354067 CTGGTGGGAGATGCTGTGCTTGG + Intergenic
1059424164 9:114210512-114210534 CTGGAAGGACAGGGTGTCTTAGG - Intronic
1060170838 9:121459668-121459690 CTGGTGGGTGATGGTGCCATTGG - Intergenic
1060522252 9:124300515-124300537 CTGGAGAGAGATGACGTCTTTGG + Intronic
1061205660 9:129161705-129161727 CAGGAGGGAGGTGGTGTGGCTGG + Intergenic
1061237718 9:129352167-129352189 CTGGCGGGAGCTGGGGTCCTCGG - Intergenic
1061516530 9:131093409-131093431 CAGGAGGGGGATGGTGTGGGTGG + Intronic
1061993365 9:134172173-134172195 CTTGAAGTAGATGGTGTCTTAGG + Intergenic
1062707550 9:137953787-137953809 CTGGAGTCAGAGGGTGTTGTGGG + Intronic
1203689762 Un_GL000214v1:30991-31013 CGCGAGGGAGATGGTGTAATGGG + Intergenic
1203646513 Un_KI270751v1:73062-73084 CGCGAGGGAGATGGTGTAATGGG - Intergenic
1186413721 X:9365314-9365336 CTGGAGGTAGATGGTGGTGATGG - Intergenic
1190620730 X:52284741-52284763 CAGGAGGGAAATGGAGTCGGGGG - Intergenic
1190777865 X:53568610-53568632 GTGGAGGTAGCTGGTGTAGTGGG - Intronic
1192068056 X:67907416-67907438 CTGGAGTGAGATGATATTGTAGG - Intergenic
1196009708 X:110873737-110873759 CTTGAGTGAGATGGTGTCCCAGG + Intergenic
1196899744 X:120371019-120371041 CTGGGGGGAAATGGTTTCATGGG + Intronic
1197551701 X:127900139-127900161 CTGAAGGGAGATGGTCTGGTGGG - Intergenic