ID: 1184140135

View in Genome Browser
Species Human (GRCh38)
Location 22:42573721-42573743
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 227}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184140135_1184140148 13 Left 1184140135 22:42573721-42573743 CCTGGGAGGCCTCCAAGTCCCTA 0: 2
1: 0
2: 0
3: 19
4: 227
Right 1184140148 22:42573757-42573779 CCTGGGGTGCTATGGACTGTCGG 0: 2
1: 0
2: 0
3: 13
4: 129
1184140135_1184140143 -4 Left 1184140135 22:42573721-42573743 CCTGGGAGGCCTCCAAGTCCCTA 0: 2
1: 0
2: 0
3: 19
4: 227
Right 1184140143 22:42573740-42573762 CCTAGGGTTAGACACCTCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 57
1184140135_1184140150 15 Left 1184140135 22:42573721-42573743 CCTGGGAGGCCTCCAAGTCCCTA 0: 2
1: 0
2: 0
3: 19
4: 227
Right 1184140150 22:42573759-42573781 TGGGGTGCTATGGACTGTCGGGG 0: 2
1: 0
2: 0
3: 3
4: 95
1184140135_1184140141 -5 Left 1184140135 22:42573721-42573743 CCTGGGAGGCCTCCAAGTCCCTA 0: 2
1: 0
2: 0
3: 19
4: 227
Right 1184140141 22:42573739-42573761 CCCTAGGGTTAGACACCTCCTGG 0: 1
1: 0
2: 1
3: 2
4: 61
1184140135_1184140144 -3 Left 1184140135 22:42573721-42573743 CCTGGGAGGCCTCCAAGTCCCTA 0: 2
1: 0
2: 0
3: 19
4: 227
Right 1184140144 22:42573741-42573763 CTAGGGTTAGACACCTCCTGGGG 0: 1
1: 0
2: 1
3: 3
4: 80
1184140135_1184140149 14 Left 1184140135 22:42573721-42573743 CCTGGGAGGCCTCCAAGTCCCTA 0: 2
1: 0
2: 0
3: 19
4: 227
Right 1184140149 22:42573758-42573780 CTGGGGTGCTATGGACTGTCGGG 0: 2
1: 0
2: 0
3: 5
4: 86
1184140135_1184140151 23 Left 1184140135 22:42573721-42573743 CCTGGGAGGCCTCCAAGTCCCTA 0: 2
1: 0
2: 0
3: 19
4: 227
Right 1184140151 22:42573767-42573789 TATGGACTGTCGGGGCTCCAAGG 0: 2
1: 0
2: 0
3: 8
4: 83
1184140135_1184140145 5 Left 1184140135 22:42573721-42573743 CCTGGGAGGCCTCCAAGTCCCTA 0: 2
1: 0
2: 0
3: 19
4: 227
Right 1184140145 22:42573749-42573771 AGACACCTCCTGGGGTGCTATGG 0: 1
1: 1
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184140135 Original CRISPR TAGGGACTTGGAGGCCTCCC AGG (reversed) Intronic
900006294 1:55653-55675 CAGGTTCTGGGAGGCCTCCCTGG - Intergenic
901672198 1:10862474-10862496 TAGGGGCTTGGAGGCCTTGGGGG - Intergenic
902188671 1:14744883-14744905 TAGTGACTTGGAGGGGTCACAGG - Intronic
902324419 1:15689963-15689985 TAGGGAGTTTGAGGCCAGCCTGG - Intronic
902329628 1:15724975-15724997 TGGTGACTTCGAGGCCTCCATGG - Intronic
902375044 1:16026616-16026638 TAGGGACTCGGGGGCTTCCTTGG + Intronic
902380015 1:16048423-16048445 TAGGGACTCGGGGGCTTCCTTGG + Intronic
903068499 1:20714867-20714889 TAGGGCCTTGGAGAGCTGCCAGG - Intronic
903748120 1:25602307-25602329 CAGGGACTTGGAGGCCTGAGGGG - Intergenic
903809077 1:26024553-26024575 AAGGTACATGGAGGCCTCCAGGG + Intronic
904597952 1:31658522-31658544 AGGGGCCTTGCAGGCCTCCCAGG - Exonic
904714924 1:32460368-32460390 TCGGGAGTTCGAGGCCACCCTGG - Intergenic
905108021 1:35575436-35575458 CAGGGCCTTGGAGGCCTCTGGGG + Intronic
906621633 1:47285665-47285687 TCGGGACTTGGAGACCAGCCTGG - Intronic
906873394 1:49509553-49509575 TTGGTATTTAGAGGCCTCCCTGG - Intronic
908350850 1:63285760-63285782 TGGGGCTTTGGAGGCCTGCCTGG - Intergenic
908745004 1:67367879-67367901 TGGTGACTTGGCAGCCTCCCAGG + Exonic
909066801 1:70944987-70945009 TGGAGACTTGGAGACCTCTCAGG - Intronic
910101964 1:83586869-83586891 TAAGTTCTTTGAGGCCTCCCGGG - Intergenic
912084388 1:105981229-105981251 TAGAGACTTGGAGGGCTCAGAGG + Intergenic
914916659 1:151823199-151823221 TGGGGACTTGGAGTCCTTTCTGG + Intronic
915235168 1:154475084-154475106 TGGGGAGTGGGAGGCCTGCCGGG + Intronic
915562166 1:156693710-156693732 TAGGGTCTCGGAGGCCCCACTGG + Intergenic
918851607 1:189697272-189697294 TTGAGAGTTGGAGGCCACCCTGG + Intergenic
923616871 1:235545451-235545473 CAGGGCCTTGGAGGCCACCCTGG + Intergenic
1064688245 10:17886609-17886631 TCAGGAGTTGGAGGCCACCCTGG - Intronic
1068162093 10:53277861-53277883 TAGGGACTTTGAGGACTCGGGGG + Intergenic
1069886042 10:71624212-71624234 GAGGGACTTGGGCGCCTCTCTGG + Intronic
1070489924 10:76966751-76966773 CGGGGACTTGGAAGCCTCCATGG + Intronic
1070796328 10:79219045-79219067 GGGGGACGTGGAGGCCTGCCTGG + Intronic
1071081406 10:81816596-81816618 TAGAGACTTGGAGGCAATCCAGG + Intergenic
1072799762 10:98384896-98384918 TGGGGACTGGGAGGGCTCACTGG - Intronic
1074012036 10:109492021-109492043 TAGGTTCTTGGAGTCCTCCTTGG - Intergenic
1074440583 10:113474280-113474302 TCAGGAGTTCGAGGCCTCCCTGG - Intergenic
1075258726 10:120945044-120945066 GAGGGACTGGGAGGGCTGCCTGG + Intergenic
1075544554 10:123345112-123345134 TAGGGACTTAGAGGATGCCCTGG - Intergenic
1075699901 10:124462383-124462405 TAGGGGGTTGGAGACCACCCTGG + Intronic
1075798070 10:125135143-125135165 TGGGGACTTGGTTTCCTCCCAGG - Intronic
1076838482 10:133032982-133033004 GAGGGGCTTGGTGCCCTCCCTGG + Intergenic
1076982391 11:211608-211630 TAGGGACTGGGGGGCTTCTCTGG - Intronic
1077918806 11:6627859-6627881 AAAGGACTTGGGGGACTCCCGGG - Intronic
1078101801 11:8334467-8334489 TAGGTACCTGCAGGGCTCCCAGG + Intergenic
1078217370 11:9322974-9322996 TAAGGAGTTGGAGACCTGCCTGG - Intergenic
1078325679 11:10378882-10378904 TAGGGACTTCAAGACCTCCCTGG + Intronic
1078365958 11:10706618-10706640 TCGGGACTTCTAGGTCTCCCTGG - Intergenic
1078878146 11:15419048-15419070 TACAGACTTGTAGGCCTCCAAGG + Intergenic
1079300626 11:19275871-19275893 TAGGTACCTGCAGGCCTCCCAGG - Intergenic
1085242207 11:75067165-75067187 TAGAGAATTAGAAGCCTCCCTGG - Intergenic
1085267266 11:75244311-75244333 TGGGGACCTGGAGGCCCTCCTGG - Intergenic
1085445309 11:76597417-76597439 GAGGGCCTGGGAGGCCTCCATGG - Intergenic
1085750693 11:79158444-79158466 TAAGGACCTGGAGGCTTCTCAGG - Intronic
1087262694 11:96028391-96028413 TGGGGTCGAGGAGGCCTCCCAGG - Intronic
1089684704 11:120139361-120139383 TAGGGGTTTGGAGGCTTCCTAGG - Intronic
1090917651 11:131180056-131180078 TCAGGACCTGGAGGCCTCCAGGG - Intergenic
1092099673 12:5872802-5872824 TAGGAACTTGGAGGGCTGACAGG - Intronic
1092317178 12:7430005-7430027 AAAGGACTTGGTGGCCTCCAAGG - Intronic
1096494276 12:52030328-52030350 TAAGGACTTTGAGGCCACACTGG + Intronic
1096509296 12:52118794-52118816 CAGGGCCTTGGAGGTCTCCTGGG - Intergenic
1096788448 12:54030996-54031018 GAGGGGCTGGGAGGCCTCTCTGG + Intronic
1097388278 12:58977661-58977683 TAAGCACTTGGAGGCTTGCCTGG + Intergenic
1101878339 12:108609887-108609909 TGGGGACATGGAGGCCTCCACGG + Intergenic
1102812590 12:115837399-115837421 TAGGGGCTAGGAAGGCTCCCTGG + Intergenic
1103607236 12:122096465-122096487 TAGAGACTTGAAAGCTTCCCAGG - Intronic
1104645512 12:130494693-130494715 CAGGGTCCTGGAGGCCTCCGTGG - Intronic
1107514620 13:41116973-41116995 TAGGGAGTTGGAGACCAGCCTGG + Intergenic
1107986624 13:45781847-45781869 TAGTCACTTGGATGCCTGCCAGG + Exonic
1108227734 13:48306058-48306080 TTGGGAGTTGGAGGCCAGCCTGG + Intronic
1111606745 13:90548242-90548264 TAGAGACTTGGAGGGCTCAGCGG - Intergenic
1113135550 13:107085112-107085134 CAGTGGCTTGGAGTCCTCCCTGG + Intergenic
1113395533 13:109944088-109944110 GAGAGACTTGGAGGCCTACAGGG + Intergenic
1113812248 13:113149870-113149892 TTGGGAATTGGACACCTCCCCGG + Intergenic
1113917540 13:113883493-113883515 GAGGGACTTGGAGGGCGCCGAGG - Intergenic
1113968264 13:114167008-114167030 CAGGGCCCTGGAGGCTTCCCAGG - Intergenic
1116863539 14:50013441-50013463 TGGAGAACTGGAGGCCTCCCTGG - Intergenic
1117340152 14:54785341-54785363 GAGGGAGCTGAAGGCCTCCCAGG - Intronic
1119094104 14:71812925-71812947 TAGGGGATTGGATGCCTCTCGGG - Intergenic
1119768631 14:77206295-77206317 AGAGGACTTGGAGGCCTCCCTGG - Intronic
1202859394 14_GL000225v1_random:72198-72220 CAGCCACTTGGAGGCCTCCAGGG + Intergenic
1125520574 15:40345874-40345896 GAGGGACAGGGAGGACTCCCTGG - Intergenic
1126119139 15:45235792-45235814 TATGGAAGTAGAGGCCTCCCAGG + Intergenic
1126773844 15:52082780-52082802 TTGGTAGTTGCAGGCCTCCCAGG + Intergenic
1128280927 15:66393643-66393665 TAGGGCCTTGTAGGCCACCATGG - Intronic
1128815658 15:70606277-70606299 TAGGGACTGGCAGGCTCCCCAGG + Intergenic
1130172224 15:81527089-81527111 TAGAGACTTGGATGGCTTCCAGG + Intergenic
1131118905 15:89810994-89811016 GAGGCACTTGGAGGGCTGCCTGG - Intronic
1132447228 15:101935305-101935327 CAGGTTCTGGGAGGCCTCCCTGG + Intergenic
1132542948 16:519867-519889 GAGGGACAAGGAGGCCACCCAGG + Exonic
1132623742 16:880268-880290 TGGGGACCTGGAAGCCTCCCAGG + Intronic
1133698819 16:8290067-8290089 GTGGGGCTTGGAGGGCTCCCTGG - Intergenic
1134043635 16:11085957-11085979 AAGTGACTTGGAGGCCTCTCGGG + Intronic
1136477188 16:30520728-30520750 GAGGGCCTGGCAGGCCTCCCAGG + Intronic
1137601026 16:49756476-49756498 TACGGAATTGGACCCCTCCCCGG + Intronic
1137665739 16:50247943-50247965 TGGGAAATTGGAGGGCTCCCTGG - Intronic
1138121237 16:54402423-54402445 TGGGGACTTGGCAGGCTCCCTGG + Intergenic
1138196029 16:55052892-55052914 TAGGGATTAGGAGCCTTCCCTGG + Intergenic
1139610322 16:68052112-68052134 TAGGGAGTTCGAGACCACCCTGG - Intronic
1139660045 16:68414551-68414573 GTGGGGCTTAGAGGCCTCCCAGG - Intronic
1143593568 17:7900555-7900577 TAGCAACTTGGAGGGCTTCCTGG + Exonic
1144659445 17:17058571-17058593 AATGGACCTGGAGCCCTCCCTGG - Intronic
1144703889 17:17355044-17355066 CAGGAACTTGGAGTCCTTCCAGG + Intergenic
1144849418 17:18236549-18236571 GAGGGGCGTGCAGGCCTCCCAGG + Intronic
1147263843 17:39223724-39223746 CAGGGGCTTGGGGGCCTCCCAGG - Intronic
1147267547 17:39244072-39244094 TGGGGAAATGGAGGCCTCCAGGG + Intergenic
1147690482 17:42311965-42311987 TGGGGCGTTGGTGGCCTCCCTGG + Intergenic
1148340227 17:46869034-46869056 CTGGGTCTTTGAGGCCTCCCAGG + Intronic
1148876740 17:50692086-50692108 GAATGACTTGGAGGCCTCACTGG - Exonic
1151681470 17:75624970-75624992 GAGGGGCTTGGAGGTCGCCCAGG - Intergenic
1151759542 17:76092834-76092856 GAGGGACAGGGAGGCCTCCCAGG - Intronic
1152394942 17:80026760-80026782 TAGGGACCTGGAGTCCTGCGGGG + Intronic
1153815079 18:8784452-8784474 TAGGTACTCAGAGTCCTCCCGGG - Exonic
1155807580 18:30191930-30191952 TGGGGACTTGGATGCCTGGCAGG + Intergenic
1155878800 18:31118625-31118647 TCGGGACTTGGAGACCATCCTGG - Intergenic
1159980657 18:74775785-74775807 TAAGTTCCTGGAGGCCTCCCTGG - Intronic
1160638048 19:97228-97250 CAGGTTCTGGGAGGCCTCCCTGG - Intergenic
1160783442 19:888853-888875 CAGGAACTAGGAGGCCTTCCTGG - Intronic
1161083522 19:2323161-2323183 TGAGGACTTGGCGGCCTCACTGG + Intronic
1162956397 19:14100963-14100985 GAAGGCCTTGGGGGCCTCCCCGG + Intronic
1163587123 19:18169997-18170019 TCGGGAGTTGGAGGCCAGCCTGG + Exonic
1165227862 19:34366791-34366813 CAGGGGCGTGGAGGCCGCCCGGG + Exonic
1165380250 19:35474357-35474379 TAGGCACCTTGAGGCCTCGCGGG - Intergenic
1165764678 19:38343351-38343373 GAGGGAGTCGGAGGCCTTCCTGG - Intronic
1166026931 19:40095285-40095307 TAGGGATATGGAGGCCAGCCTGG - Intergenic
1166648010 19:44547222-44547244 AAGGGAGTTGGAGGCCTTGCAGG + Intergenic
1167989698 19:53347978-53348000 TAAGGAGTTTGAGGCCACCCTGG + Intronic
925917288 2:8615725-8615747 TAGGGAATTGGAAGCCTCTGGGG - Intergenic
926431132 2:12786680-12786702 TAGAGACTTGGAGGGCTCAGAGG - Intergenic
926701587 2:15807676-15807698 TAGGGCCTTGGAGTGCTCCACGG + Intergenic
926760596 2:16275463-16275485 TAGGCATCTGGAGTCCTCCCTGG + Intergenic
929013064 2:37466951-37466973 TAAGAACTTGGATGACTCCCAGG + Intergenic
929532112 2:42759881-42759903 TAGGGGCTTGGAAGACACCCAGG - Intergenic
932197383 2:69796341-69796363 TAGGGACTGGGAGGAGCCCCAGG - Intronic
932943216 2:76194517-76194539 TATGGACTTGGAGGGCCCTCGGG - Intergenic
935112949 2:100108545-100108567 TAGGGAGTTGGAGACCTTTCTGG + Intronic
937767726 2:125680643-125680665 TAGGGACCTGGCGAGCTCCCAGG + Intergenic
937853836 2:126658327-126658349 TGGGGACTTGCAGAGCTCCCTGG + Intronic
939143110 2:138379241-138379263 TGGGGCCATGGAGGCCTACCTGG - Intergenic
941674003 2:168324646-168324668 TTGGGGCTTGGAGGCCACACAGG + Intergenic
942341241 2:174950049-174950071 TCGGGAGTTGGAGACCTTCCTGG + Intronic
942418138 2:175780362-175780384 CAGGAACTTGGAAGCCTCACAGG + Intergenic
944202056 2:197118000-197118022 TCGGGAGTTGGAGGCCAGCCTGG + Intronic
948125840 2:235564369-235564391 AAGGCACCTGGAGGCCTCCCTGG - Intronic
948146459 2:235711761-235711783 TAGGCACTTGGAGGCTGCCTAGG - Intronic
948478901 2:238238720-238238742 TAGGGCCCTGGAAGTCTCCCAGG - Exonic
948664143 2:239523985-239524007 TAGGGGCATGGAGGCCAGCCTGG + Intergenic
948844384 2:240676232-240676254 TTGGGACCTGGCGGACTCCCTGG + Intergenic
948845910 2:240682754-240682776 CAGGGCCTTGGAGGCCCGCCTGG + Exonic
948847948 2:240691975-240691997 CAGGGCCTTGGAGGCCCGCCTGG - Exonic
948849474 2:240698647-240698669 TTGGGACCTGGCGGACTCCCTGG - Intergenic
948935311 2:241160130-241160152 GAGGGATTTGGAGGCTGCCCAGG - Intronic
1169964182 20:11196715-11196737 CAGGGACATGCAGGCCTACCAGG + Intergenic
1172663509 20:36583549-36583571 TAAGGAGTTGGAGACCTACCTGG + Intronic
1172672104 20:36641692-36641714 TAGGGGCTGGGAGGCTTCCTGGG - Intronic
1173176837 20:40771161-40771183 GAGGCAATTGGAGGCCTCCGAGG + Intergenic
1173244836 20:41329506-41329528 TAGGGACTTAGAAGGCTGCCAGG - Intergenic
1173907623 20:46640361-46640383 CAGGGGCTTGCTGGCCTCCCCGG + Intronic
1176144257 20:63558475-63558497 TCAGGACAAGGAGGCCTCCCTGG - Intronic
1176999074 21:15589612-15589634 TAGGGACCTGGAGGGATTCCTGG - Intergenic
1179594104 21:42430719-42430741 TAGGGAGCTGCAGGTCTCCCTGG - Intronic
1181020645 22:20100412-20100434 GAGGGCCTTGGAAGCCTCCCTGG - Intronic
1181167363 22:20990986-20991008 AAGGGACTTGGGAGCTTCCCTGG + Intronic
1182444971 22:30384670-30384692 GATGGACTTGCAGGCTTCCCTGG - Intronic
1183055051 22:35300039-35300061 TAGGCACCCGGAGGCTTCCCAGG - Intronic
1183566619 22:38620043-38620065 GGGAGACCTGGAGGCCTCCCAGG + Intronic
1183759168 22:39799882-39799904 TTGGGGGTTGGAGGACTCCCAGG + Intronic
1184129959 22:42511903-42511925 TAGGGACTTGGAGGCCTCCCAGG - Exonic
1184140135 22:42573721-42573743 TAGGGACTTGGAGGCCTCCCAGG - Intronic
950090355 3:10290431-10290453 TAGGGGCTGGGGGTCCTCCCCGG + Intronic
953253345 3:41265916-41265938 TAGGGGCTTGGAAAACTCCCAGG + Intronic
954133288 3:48570691-48570713 TAGGGTCTGGCAGGCCCCCCAGG - Exonic
954809321 3:53238446-53238468 AAGGGACTGTGAGGCCTCCTTGG + Intronic
955361883 3:58282846-58282868 TCTGCACTTGGAGGCCTCACAGG - Intronic
960386574 3:117028006-117028028 TAGGGGGTTAGAGGCCTCTCTGG + Intronic
961001395 3:123376461-123376483 TCTGGACTTGGAGACCACCCTGG - Intronic
965683205 3:171273297-171273319 TTGGGCCATGGAGGCCTTCCTGG + Intronic
966940211 3:184741318-184741340 TTGGGACTTGCCGGCCTGCCGGG - Intergenic
968707857 4:2091421-2091443 GAGGGTCTGGGAGGCCTTCCAGG + Intronic
969259402 4:6024005-6024027 CAGGGTGTTGGAGGCCTCGCTGG - Intergenic
969705754 4:8790314-8790336 CAGGGATGTGGGGGCCTCCCCGG - Intergenic
976489558 4:85653692-85653714 TAAGGAGTTGGAGGCCAGCCTGG - Intronic
979318011 4:119289456-119289478 AAGGGTCTCGGAGACCTCCCGGG + Intronic
979989241 4:127355012-127355034 TAGGGTCATGGCGGCCACCCTGG + Intergenic
982263902 4:153520985-153521007 AAGTGACTTGCAGTCCTCCCTGG + Intronic
982864613 4:160494077-160494099 TAGGCACATGGAGGCTTCCAAGG + Intergenic
985694847 5:1334239-1334261 CAGGCACTTGGGGGGCTCCCTGG - Intronic
987816076 5:22902096-22902118 CAGGGACAAGGAGGCCTCCCAGG + Intergenic
988554516 5:32224650-32224672 TAGGCACTTGGACACATCCCTGG + Intergenic
989005336 5:36804646-36804668 TAGGGACTCGGGGGAGTCCCAGG - Intergenic
989605999 5:43245314-43245336 CAGGGACGTGGGGGCCTCCCAGG + Exonic
991706396 5:69362578-69362600 TGGGGAATTGGAGACCACCCTGG + Intronic
992917616 5:81474543-81474565 TAGGCACTTGGAGGTGTCCCAGG - Exonic
995055321 5:107753106-107753128 TAGAGACTTGGAGGGCTCAGAGG + Intergenic
995639240 5:114234781-114234803 TAGAGAGTTGTGGGCCTCCCTGG + Intergenic
996167335 5:120241334-120241356 TAGGGACAAGGAGGCTTTCCTGG + Intergenic
997025435 5:130055010-130055032 TATGGAGGTGGAGGACTCCCTGG + Intronic
997491288 5:134278806-134278828 TAGGGAGTTGGAGACCAGCCTGG - Intergenic
997745553 5:136297004-136297026 TAGGGACTTGCAGGTGTCCTGGG - Intronic
1001631533 5:173179142-173179164 TGTGGAGGTGGAGGCCTCCCAGG + Intergenic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1002394557 5:178942594-178942616 TGGGGTACTGGAGGCCTCCCAGG + Intronic
1002811167 6:631000-631022 CAGGGCCTTGGAGGCCTAGCTGG - Intronic
1002929612 6:1624308-1624330 GAGGGACGCGGAGGCCTCTCTGG - Intronic
1005818567 6:29577667-29577689 TTGTGTCTTGGAAGCCTCCCAGG + Intronic
1005954188 6:30652039-30652061 TAAGGAGTTGGAGACCTGCCTGG + Intronic
1006382317 6:33706736-33706758 CAGGCTCTTGGAGCCCTCCCTGG - Intronic
1006848521 6:37080422-37080444 TCGGGAGTTCGAGGCCTGCCTGG + Intergenic
1011460617 6:87599575-87599597 TCAGGACTTGGAGACCACCCTGG - Intronic
1014172688 6:118296300-118296322 TAGGCACTTGGAGTCCTCTGTGG + Intronic
1015135206 6:129861486-129861508 CAGGGACTTGGAATCCTCTCTGG + Intronic
1015555759 6:134459777-134459799 TAGGGTCTTGGAGGCCACAGTGG - Intergenic
1017993011 6:159506493-159506515 TAGGGACCTAGAGGCCTCTGAGG + Intergenic
1024963912 7:55005081-55005103 TGAGGACTTGGAGGCCTCACTGG - Intergenic
1025611427 7:63078219-63078241 TAGGCACTTGCAGGCATCCTGGG + Intergenic
1025708201 7:63886266-63886288 CAGGCGCTTGGAGGCATCCCAGG - Intergenic
1026538479 7:71260081-71260103 TGTGGACTTGGAGGCCATCCTGG + Intronic
1027170995 7:75872345-75872367 CAGGGACCAGGAGGCCTCCCTGG - Intronic
1028334628 7:89636609-89636631 TAGGGACTTTGGGACCTCCAAGG + Intergenic
1029404459 7:100366421-100366443 TGTGGACGTGGAGCCCTCCCAGG + Intronic
1029694906 7:102206190-102206212 TGGGGACTTGGATGCCACCGAGG - Intronic
1031404518 7:121368679-121368701 TAGGAACTTGTAGGCCACGCAGG - Intronic
1033431466 7:141293326-141293348 TAGTGAATTGCAGGCCTTCCAGG - Intronic
1033622032 7:143070194-143070216 TAGGGACTTGGCCACATCCCAGG + Intergenic
1034326374 7:150237589-150237611 TAGGTACTTGGAGTTCTTCCAGG - Intergenic
1034766840 7:153731667-153731689 TAGGTACTTGGAGTTCTTCCAGG + Intergenic
1035296404 7:157869241-157869263 TAGGGCCTTGGAGGCCTGCTGGG + Intronic
1036523354 8:9512767-9512789 TAGGGACTTCGAGACCAGCCTGG - Intergenic
1036769862 8:11571546-11571568 TGGGGACTTCGTGGCCTCTCAGG + Intergenic
1041052546 8:53951805-53951827 TAGGGAGTTTGAGGCCAGCCTGG + Intronic
1041420860 8:57666126-57666148 TCGGGACTTGGAGCCCAGCCTGG + Intergenic
1042134547 8:65620509-65620531 TAGGGAGTTCGAGGCCAGCCTGG - Intronic
1048629693 8:136228651-136228673 TAGGGACTTCTAGGTCTCACAGG + Intergenic
1048851756 8:138652115-138652137 GAGGGACTCGGGGGGCTCCCAGG - Intronic
1049297206 8:141848503-141848525 TAGTGCCTTGGAGTCCTCCCTGG + Intergenic
1049757308 8:144316413-144316435 TAGGGGCAGAGAGGCCTCCCTGG + Exonic
1055603428 9:77943874-77943896 TAGGGAGTTGGAGACCAGCCTGG - Intronic
1058325887 9:103697152-103697174 TAGGGACTGGGAGGTCTGGCAGG + Intergenic
1060554183 9:124499952-124499974 TGGGGACCCGGAGGCCACCCTGG - Intronic
1061308714 9:129748561-129748583 AGGGGACTTGGAGGACTCCCAGG - Intronic
1061861332 9:133470034-133470056 TGGGGACTTGGTGGGCTCCTGGG + Exonic
1062388317 9:136323873-136323895 CAGGGACTTGGAGGTCCCCAAGG + Intergenic
1203750606 Un_GL000218v1:75656-75678 TCGGGAGTTGGAGACCACCCTGG - Intergenic
1185997407 X:4967339-4967361 TAGGGTCATGGAGGCCACACTGG - Intergenic
1187131952 X:16511771-16511793 CAGGGATGTGGAGGCTTCCCAGG + Intergenic
1192942726 X:75930097-75930119 CAGGGAGTTGGAGGCCAGCCTGG - Intergenic
1194843522 X:98775373-98775395 TAGAGACTTGGAGGGCTCAAAGG + Intergenic
1195223123 X:102765631-102765653 TAGGGATGTGGGGGCCTCTCAGG - Intergenic
1195838745 X:109149357-109149379 TAGAGACTTGGAGGGCTCAGAGG + Intergenic
1198554863 X:137782315-137782337 TAGGGAGTTGGAGACCAGCCTGG - Intergenic
1199676385 X:150193480-150193502 AAGGGTCTTGGAGACCTCCACGG + Intergenic