ID: 1184141484

View in Genome Browser
Species Human (GRCh38)
Location 22:42580256-42580278
Sequence AGTCCACCTGGCCTCAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141484_1184141488 15 Left 1184141484 22:42580256-42580278 CCTCTTCTGAGGCCAGGTGGACT No data
Right 1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG 0: 1
1: 1
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141484 Original CRISPR AGTCCACCTGGCCTCAGAAG AGG (reversed) Intergenic
No off target data available for this crispr