ID: 1184141486

View in Genome Browser
Species Human (GRCh38)
Location 22:42580268-42580290
Sequence AACAAGGCACCAAGTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 1, 2: 3, 3: 10, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141486_1184141488 3 Left 1184141486 22:42580268-42580290 CCAGGTGGACTTGGTGCCTTGTT 0: 1
1: 1
2: 3
3: 10
4: 125
Right 1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG 0: 1
1: 1
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141486 Original CRISPR AACAAGGCACCAAGTCCACC TGG (reversed) Intergenic
901427715 1:9193196-9193218 AACAAGGCTCTCAGGCCACCAGG + Intergenic
901571940 1:10167926-10167948 AATAAGGCACCAACATCACCTGG + Intronic
903192423 1:21664176-21664198 ATCAAGGCACCAAGCCACCCGGG - Intronic
903671434 1:25037989-25038011 AGCAAGGGACCAAGAGCACCAGG + Intergenic
905167993 1:36094350-36094372 CACACGGCACTCAGTCCACCCGG - Intergenic
909194808 1:72605286-72605308 AACAAGGCACTGATACCACCAGG + Intergenic
910510321 1:87996517-87996539 AACAAATCACCATGTCTACCAGG - Intergenic
919031958 1:192253027-192253049 AACTAGGCAGAAAATCCACCAGG - Intergenic
919526681 1:198662038-198662060 AAGAAGCCACCATGTCCAACTGG + Intronic
919568778 1:199220919-199220941 AACAAGGCACCATTTCCCCAGGG + Intergenic
921177006 1:212604483-212604505 CACAAGGCACCTAGTCCATGGGG + Intronic
923215602 1:231845484-231845506 AAATGGGCACCAAATCCACCTGG - Intronic
924229281 1:241949845-241949867 AAAAAGGCACACAGTCCAGCAGG + Intergenic
1067173541 10:43926648-43926670 ACCAGGGCACCAAGACCACAGGG + Intergenic
1072688472 10:97553601-97553623 AACAACTCACCAAGTTCTCCAGG - Intronic
1074849991 10:117432116-117432138 GACAAGTCACCAAGACCACGTGG - Intergenic
1078186964 11:9060370-9060392 AACAGGGCACCCAGTCTCCCTGG + Intronic
1078762637 11:14263605-14263627 AACAATGCACCAAGTGCTCAGGG + Intronic
1082955382 11:58864378-58864400 ACCCAGAAACCAAGTCCACCAGG + Intronic
1082962852 11:58935183-58935205 ACCCAGAAACCAAGTCCACCAGG + Intronic
1085533158 11:77203415-77203437 CACAAGGCACCAAATCCACCTGG - Intronic
1085607552 11:77915645-77915667 AGCAAGTCACCAAGTCCCCCAGG + Intronic
1086059312 11:82683729-82683751 AAAAAGGCACCAACTCGACTGGG + Intergenic
1086270300 11:85055369-85055391 AACAAGTCACGAAGTCAGCCAGG + Intronic
1087364282 11:97199008-97199030 AACTAGGCATCAAGTCCTACAGG - Intergenic
1089366631 11:117924681-117924703 AAAAAGTCACCCAGTCCAGCCGG - Intronic
1089424905 11:118364839-118364861 ATCAAGCCACCGAGTCCAGCTGG + Intronic
1090402309 11:126456652-126456674 CACCAGGCCCCAAGTCCACGGGG - Intronic
1091156341 11:133377624-133377646 AAAAGAGCACCAAGTCCACAGGG + Intronic
1092657959 12:10707114-10707136 AGCAAGGGATCAAGTCCATCAGG - Intronic
1093765717 12:22959665-22959687 AACAAGGCACCTTCTCCACAAGG - Intergenic
1094043420 12:26141597-26141619 AAAAAGGCACCACCACCACCTGG + Intronic
1094140688 12:27179122-27179144 ATGAAGGCACCAATTCCATCAGG + Intergenic
1096744534 12:53716826-53716848 AGCATGGCACCAAGGGCACCAGG - Intronic
1097674787 12:62588289-62588311 AACAAAGCATCAAGTCCATTAGG + Intronic
1098153211 12:67569782-67569804 ATAAAGGCACCAATCCCACCAGG + Intergenic
1101975566 12:109355129-109355151 AGGAAGGAACCAAGACCACCAGG - Intronic
1104187146 12:126443856-126443878 AACAATTCACCAAGTGCATCAGG - Intergenic
1107961914 13:45566488-45566510 TGCAAGGCACCAAGTCCCCTAGG - Intronic
1113393958 13:109926399-109926421 AACATGGCACCAATTCCAGAAGG - Intergenic
1114999179 14:28401144-28401166 TAGAAGGCACCAAATCTACCTGG - Intergenic
1117416440 14:55500885-55500907 AACAAGAAAACAAGTCCAACTGG + Intergenic
1118382834 14:65231524-65231546 AGCAAGGCTCCTAGTCCAGCGGG + Intergenic
1119687692 14:76645625-76645647 ATCAAGGAATCAAGTGCACCAGG - Intergenic
1121002974 14:90465321-90465343 AACAAGGCACCCAGCCCTCTGGG + Intergenic
1121228770 14:92341147-92341169 AGCAAGACACAAAGGCCACCAGG - Intronic
1122017088 14:98805525-98805547 ATCAAGGCACCAAGTCATGCAGG - Intergenic
1123392527 15:19890765-19890787 AACAAGACACAAAGTCAACAAGG + Intergenic
1124213523 15:27784328-27784350 AACCACGAACCAAGTCCTCCTGG + Intronic
1127200867 15:56648471-56648493 AACAAGGCAGGATGTACACCTGG + Intronic
1128690987 15:69724848-69724870 AACAAGGAACAGAGTCCTCCTGG + Intergenic
1132389509 15:101428143-101428165 GAGAAGGCACCAAGTCAGCCTGG + Intronic
1132974004 16:2702588-2702610 AAGAAGTCAGCAAGGCCACCAGG - Intronic
1135299518 16:21313514-21313536 GACCAGAGACCAAGTCCACCAGG + Intergenic
1135772332 16:25227037-25227059 ACCCAGGCACCAAGGTCACCAGG - Intronic
1138238675 16:55408299-55408321 AACAGGGCAGCAGGTGCACCAGG + Intronic
1140962215 16:79927086-79927108 GACAATGCACCAATTCCAACAGG - Intergenic
1144659778 17:17060455-17060477 AAACAGGCACCAAGGCCACCTGG - Intronic
1145056493 17:19706960-19706982 AACAGGGCACCAGGCTCACCTGG + Intronic
1146280607 17:31541883-31541905 AACCCTGCACCAAGTCCACTGGG + Intergenic
1150387232 17:64772075-64772097 AAAAAGGCACCAGGTCCAGAGGG + Intergenic
1151812287 17:76451834-76451856 AACAAGCCACCAAACCAACCCGG + Intronic
1152581578 17:81167693-81167715 GACAAGACACCAACTGCACCTGG + Intergenic
1155162867 18:23209620-23209642 AACAAGCAACCAAGTCCAAGAGG - Intronic
1157726983 18:49972125-49972147 AACAGGAGACCAAGTCCTCCAGG + Intronic
1157940072 18:51918812-51918834 AGCAAGGCTCCAAGGCCAGCAGG - Intergenic
1159138888 18:64369188-64369210 TAGAAGGCACCAAATCTACCTGG - Intergenic
925918321 2:8623028-8623050 AACGAGGCACTGAGTTCACCAGG - Intergenic
926633390 2:15157571-15157593 AACCAGGCACCAAGTTCAACCGG + Intergenic
926721936 2:15967361-15967383 ACCAGGGGACTAAGTCCACCAGG + Intergenic
928330985 2:30357665-30357687 AACAAAGCACCTTGTCCACCTGG - Intergenic
929229343 2:39543141-39543163 AACAAGGCACCTAGTCTATTTGG + Intergenic
932319203 2:70808800-70808822 AACAAGGCAGGAAGTCCACAAGG + Exonic
932559584 2:72855447-72855469 AGCAAAGCACCGAGTCCACAGGG + Intergenic
933733450 2:85476203-85476225 ATCACTGCACCAAGTCCAGCTGG + Intergenic
934709637 2:96506532-96506554 CACAAGGCTCCAAACCCACCAGG - Intronic
937682161 2:124655609-124655631 GCCATGGCACCCAGTCCACCTGG - Intronic
941859316 2:170262581-170262603 AACCAGTCACCAACTCCACATGG - Intronic
942313904 2:174681744-174681766 TAAAAGGGACCAAGTCCACTTGG + Intronic
945758528 2:213881594-213881616 AACAAGGCACCTTCTCCACAAGG + Intronic
948127419 2:235574715-235574737 AATAATGGACCAAGTACACCAGG + Intronic
1169911783 20:10653054-10653076 AACAAGCCACCAAGTGCAGCAGG + Intronic
1173503654 20:43570818-43570840 AACAAAGGACCAAGTCCACCAGG - Intronic
1173971681 20:47157801-47157823 AAAAAGGCACCAGGTCCCACTGG + Intronic
1175698955 20:61123599-61123621 AACAAGGCCCAGAGTCCAGCAGG - Intergenic
1178087382 21:29125629-29125651 AACAAGACACCACCTCCCCCAGG - Intronic
1183488865 22:38106169-38106191 AACAAGGCCCCAAGGCCCCTGGG - Intronic
1184131264 22:42518056-42518078 GACAAGGCACCAAGTCCACCTGG - Exonic
1184141486 22:42580268-42580290 AACAAGGCACCAAGTCCACCTGG - Intergenic
1185170741 22:49292303-49292325 AACAGGGCACAAAGTCATCCAGG + Intergenic
1185386812 22:50536257-50536279 AACATGGCACCAAGTCAACCTGG - Intergenic
953781462 3:45874729-45874751 AGCAAGTCACAAAGTCCGCCCGG - Intronic
954634598 3:52064730-52064752 AGCAGGGAACCCAGTCCACCTGG - Intergenic
955263530 3:57419235-57419257 AACATGCCAACAAGTCCCCCAGG + Intronic
957175931 3:76809528-76809550 ATCAAATCACCAATTCCACCTGG + Intronic
957991865 3:87636405-87636427 GATAAGGCACCAATTCCTCCTGG - Intergenic
962874248 3:139523634-139523656 AACAAAGCACCTACTTCACCAGG + Intronic
965195345 3:165587600-165587622 AACAAGACACAAAGTCAACAAGG + Intergenic
967109232 3:186278779-186278801 AACAGGGCAGCAAGTGCAGCTGG - Intronic
968793405 4:2685238-2685260 AACAAGGGACCAAGGCTACTTGG - Intronic
974422063 4:61689296-61689318 AACATGGCCCAAAGACCACCTGG - Intronic
980164565 4:129209720-129209742 AACGATGGACCAAGTCCTCCTGG + Intergenic
982292726 4:153794743-153794765 ACCAAGGAACCAAATCCACCAGG - Intergenic
984474988 4:180224743-180224765 AACAAAGCACAAAGGACACCTGG - Intergenic
985835366 5:2268063-2268085 AACAAGGAAACAAGTCCTGCTGG + Intergenic
987386932 5:17338816-17338838 CACAAGGCACAAATCCCACCGGG + Intergenic
987764861 5:22212873-22212895 GAAAAGGCACCAAGGCCACTTGG + Intronic
990451577 5:55936143-55936165 AATCAGTCAGCAAGTCCACCTGG - Exonic
991899598 5:71446019-71446041 GAAAAGGCACCAAGGCCACTTGG + Intergenic
991925414 5:71700722-71700744 AACAAGGCACCTTGTTCACAAGG + Intergenic
999568812 5:152895556-152895578 AACATGGCAGCAAGACCACTAGG + Intergenic
1001287365 5:170433832-170433854 AACAAGGCACCAATTTACCCAGG + Intronic
1202774940 5_GL000208v1_random:60998-61020 AACAAGACAGAAAGTCCACAGGG - Intergenic
1003128892 6:3378273-3378295 AACATGGCCCGAAGTCCATCAGG + Intronic
1005887288 6:30106544-30106566 AAGAAGGCACAATGGCCACCTGG - Intronic
1011784206 6:90826219-90826241 CACAGGGCACCAAGTCCCCAGGG - Intergenic
1014189100 6:118471774-118471796 AAAAAAGCACCAAGTCAACAAGG + Intronic
1015695442 6:135975251-135975273 TACAATGCAGCAAGTTCACCAGG + Intronic
1016240079 6:141919303-141919325 AACAAGACAGAAAGTCCACAAGG + Intergenic
1018881331 6:167884539-167884561 GACAAGGCACCTAGTCACCCAGG - Intronic
1021270482 7:18578366-18578388 AACATGGCCCAAAATCCACCTGG - Intronic
1025845400 7:65192284-65192306 AGCAAGTCACCAAGTCCCCCAGG - Intergenic
1025895676 7:65698316-65698338 AGCAAGTCACCAAGTCCCCCAGG - Intergenic
1032319782 7:130875437-130875459 GACAAGGCCCAAATTCCACCAGG + Intergenic
1032380676 7:131476956-131476978 ACCAGGGTACCAAGTCCAACGGG + Intronic
1033313891 7:140282191-140282213 CTCAAGGCCCCATGTCCACCTGG - Intergenic
1033896447 7:146076563-146076585 AACAAGGCAACAAGCCCACAAGG - Intergenic
1038397636 8:27258814-27258836 AAACAGGCACCAAGCCCTCCAGG - Intergenic
1041758270 8:61337383-61337405 AACTAGGCTCCAAGTTCATCGGG - Intronic
1048048880 8:130798460-130798482 TACAAGCCAACAAGCCCACCTGG - Intronic
1057438707 9:95065698-95065720 TACAAGGAACCAGGTCCCCCCGG + Intronic
1057451646 9:95167871-95167893 AACAAGACACAAAGTAAACCAGG - Intronic
1060865435 9:126991500-126991522 AACCAGGCACCAAGTCCCTATGG - Intronic
1187566637 X:20456686-20456708 AGCAAGGCACCAACTTCACAAGG - Intergenic
1190024135 X:46907245-46907267 AAGAAGGCTCCAGGTCCACATGG + Intergenic
1190134905 X:47787224-47787246 AACAAGACAGAAAGTCCACAAGG - Intergenic
1190135281 X:47790441-47790463 AACAAGACAGAAAGTCCACAAGG + Intergenic
1199346355 X:146745976-146745998 AACAAGGTACCAACTTCACAAGG + Intergenic
1200583284 Y:4975820-4975842 AACCAGACACAAAGTCAACCAGG + Intergenic
1201585629 Y:15557785-15557807 AACAAGGCACCAGTTGCAACTGG - Intergenic