ID: 1184141488

View in Genome Browser
Species Human (GRCh38)
Location 22:42580294-42580316
Sequence TGCCGTGTGCTCTCACATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141484_1184141488 15 Left 1184141484 22:42580256-42580278 CCTCTTCTGAGGCCAGGTGGACT No data
Right 1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG 0: 1
1: 1
2: 0
3: 4
4: 70
1184141486_1184141488 3 Left 1184141486 22:42580268-42580290 CCAGGTGGACTTGGTGCCTTGTT 0: 1
1: 1
2: 3
3: 10
4: 125
Right 1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG 0: 1
1: 1
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141488 Original CRISPR TGCCGTGTGCTCTCACATAG AGG Intergenic
907130956 1:52096470-52096492 TGCCTTTTGCTGTCACATTGAGG - Intergenic
907612524 1:55886874-55886896 TGCCTTGTGCTCTGACTGAGGGG + Intergenic
918775220 1:188620188-188620210 TTCCATGTGTTTTCACATAGTGG - Intergenic
920964413 1:210690283-210690305 TGCTGAGTGCTCTCAGACAGTGG - Intronic
1063147937 10:3313472-3313494 TGTCCTGTGCTCACACATTGGGG - Intergenic
1065854480 10:29818872-29818894 TGCTGTGTGTTCTCACCTGGCGG - Intergenic
1068661212 10:59625228-59625250 TACCGTGTGTTCTCACATATGGG + Intergenic
1069848470 10:71389853-71389875 CACAGTGTGCTCACACATAGAGG - Intergenic
1073646715 10:105312269-105312291 TTCCATGTGCCCTCACATGGTGG - Intergenic
1075389466 10:122082484-122082506 TGCAGGGGGCTCTCACAGAGAGG + Intronic
1085045800 11:73352741-73352763 TTCTGTGTGCACTCACACAGGGG + Intronic
1095444391 12:42269756-42269778 TTCACTGTGTTCTCACATAGTGG - Intronic
1100741801 12:97602092-97602114 TGCCTTGTGCACTCACACTGAGG - Intergenic
1102577866 12:113868045-113868067 TGCTGTGTGCTCTTAAATAAAGG - Intronic
1103184312 12:118943200-118943222 TGCTGTGTGCTCTCACACACAGG + Intergenic
1104645693 12:130495759-130495781 TGCCCAGTGATCTAACATAGTGG - Intronic
1104757565 12:131278664-131278686 TGCTGGGTGCTCTCACATGCTGG - Intergenic
1105115362 13:16687610-16687632 TGACGTGTGCACTCACCTAACGG + Intergenic
1108263255 13:48679139-48679161 TGCCATGTGCTCTCAACTTGGGG + Intronic
1109746884 13:66635466-66635488 TGCCATGTGTTCACACATGGGGG + Intronic
1109803602 13:67407130-67407152 TGCTTTGTGGTCTCACTTAGGGG + Intergenic
1116120134 14:40712284-40712306 TACCGCATGCTCTCACATAAGGG + Intergenic
1121860459 14:97312975-97312997 TGCCCTGAGCTCTTACATTGAGG - Intergenic
1122310599 14:100791900-100791922 TGCCGTGTGCCCACTCAGAGAGG - Intergenic
1131121184 15:89824203-89824225 TGCCCTGTGCTCTGCCTTAGGGG + Intergenic
1133451618 16:5908895-5908917 TGCTGTGTCCTCACACAGAGAGG - Intergenic
1140441860 16:74993993-74994015 TGCCATGTTCTCTCACATCTGGG + Intronic
1142895608 17:2975828-2975850 AGCCGTGTGCTCCCACGTGGTGG + Intronic
1143337858 17:6186954-6186976 TGCTGTGTCCTCTCATAGAGGGG - Intergenic
1151229684 17:72675296-72675318 TGCTGTGTAGCCTCACATAGTGG - Intronic
1151680251 17:75619312-75619334 TGCCCTCTGCTCACACAGAGGGG - Intergenic
1155421156 18:25657956-25657978 TGCCACGTGATCTCACATATAGG - Intergenic
1164630412 19:29758146-29758168 TGCGGTGTCCTCCCACATAAGGG + Intergenic
924996764 2:368554-368576 GCCTGTGTGCCCTCACATAGAGG + Intergenic
927976194 2:27340182-27340204 TTCTGTGTTCTCTCACATAATGG - Intronic
930928533 2:56851479-56851501 TGCATTGTTCTCTCACATATGGG + Intergenic
934064356 2:88326496-88326518 GTCCCTGTGTTCTCACATAGTGG - Intergenic
940672984 2:156693641-156693663 TTCTCTGTGCTCTCACATGGTGG - Intergenic
941721901 2:168821274-168821296 AGCAGTGTGCTCTAACATCGGGG + Intronic
943184989 2:184597272-184597294 TGCAGTTTGTTCTGACATAGGGG + Intergenic
944575778 2:201089866-201089888 TGAAGTTTGCTCTCACATGGCGG + Intergenic
1171195026 20:23190091-23190113 TGCCATGTGGCCTCACATCGAGG - Intergenic
1171517780 20:25751194-25751216 GGCCGTGTGCGCCCACATACTGG + Intergenic
1173458754 20:43224926-43224948 TGCCGAGTGCTCTTGCAAAGGGG - Intergenic
1173462541 20:43254915-43254937 TGCCCTTTGCACTCACGTAGAGG + Intergenic
1176061021 20:63173049-63173071 TGCCGCCTGCTCCCACTTAGAGG + Intergenic
1177165860 21:17603000-17603022 TGTCATGTGGTCTGACATAGAGG - Intronic
1179158569 21:38873463-38873485 TGCCTTGTGGACTCACACAGAGG - Intergenic
1180913874 22:19471937-19471959 TGCACTGTGCTCTCACAGAGGGG - Intronic
1184131266 22:42518082-42518104 CGCCGTGTGCTCTCACATAGAGG + Exonic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
950795975 3:15510975-15510997 TGCCTTTTACTCTCACATAATGG + Intronic
957005763 3:74944849-74944871 TGCCCTGTGTCCTCACATGGCGG - Intergenic
961871594 3:129992609-129992631 TGCCATGAGTGCTCACATAGCGG + Intergenic
971522558 4:27572357-27572379 TGACGTCTGCTTTCACATGGAGG - Intergenic
973903058 4:55497400-55497422 TGCCATGTACCCTAACATAGTGG + Intronic
974750522 4:66134648-66134670 TTCTGTGTGTTCTCACATAGTGG + Intergenic
977191570 4:94007532-94007554 TTCCATGTGCTCCCACATACAGG + Intergenic
996841552 5:127852404-127852426 TGCAGTGTTTTCTCACATGGGGG + Intergenic
1004224939 6:13776576-13776598 TGCTGTGTCCTCACACAGAGTGG - Intergenic
1006361016 6:33586994-33587016 TGCAGTGTGCACTCACTCAGGGG - Intergenic
1017371467 6:153714221-153714243 TGCACTGTGCCCTCACATGGGGG + Intergenic
1018947148 6:168355974-168355996 TTCCGTGTGCTCTGACTTTGGGG - Intergenic
1034996830 7:155582622-155582644 TTCGATGTGCTCTCACATGGTGG - Intergenic
1036758338 8:11486692-11486714 TGCCTTGTGCCTTCACATAAAGG - Intergenic
1038711161 8:29947161-29947183 TGCCATGTGCTTTCCCAGAGTGG + Intergenic
1044001715 8:86890321-86890343 TACCATATGATCTCACATAGAGG - Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1046739188 8:117810763-117810785 TGCCCTGTGCCCTCAGATAATGG + Intronic
1048874638 8:138827386-138827408 TTCCCTGTACTCTCACATGGTGG - Intronic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1058596525 9:106621455-106621477 TGCATTGTGCACTCACATAAAGG - Intergenic
1186172578 X:6892810-6892832 TGCTGTGCCCTCTCACATGGTGG - Intergenic
1196108861 X:111924977-111924999 TGCTGATTGCTGTCACATAGAGG + Intronic
1197004791 X:121482396-121482418 TTCTGTGTGTTCTCACATGGTGG + Intergenic
1197920823 X:131591899-131591921 TGGCATGTGCTCTAACAGAGGGG + Intergenic