ID: 1184141815

View in Genome Browser
Species Human (GRCh38)
Location 22:42581969-42581991
Sequence GCAGGACGAAGCTCGCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141815_1184141818 -1 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141818 22:42581991-42582013 CGCGCCACCATCTTGCCACCCGG No data
1184141815_1184141824 9 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141824 22:42582001-42582023 TCTTGCCACCCGGGAGCGCGGGG No data
1184141815_1184141830 18 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141830 22:42582010-42582032 CCGGGAGCGCGGGGGTCGCCGGG 0: 1
1: 1
2: 1
3: 37
4: 314
1184141815_1184141825 10 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141825 22:42582002-42582024 CTTGCCACCCGGGAGCGCGGGGG No data
1184141815_1184141828 17 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141828 22:42582009-42582031 CCCGGGAGCGCGGGGGTCGCCGG 0: 1
1: 1
2: 2
3: 51
4: 384
1184141815_1184141822 7 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141822 22:42581999-42582021 CATCTTGCCACCCGGGAGCGCGG No data
1184141815_1184141823 8 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141823 22:42582000-42582022 ATCTTGCCACCCGGGAGCGCGGG No data
1184141815_1184141831 26 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141831 22:42582018-42582040 GCGGGGGTCGCCGGGAGTTGCGG 0: 1
1: 1
2: 3
3: 19
4: 240
1184141815_1184141819 0 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141819 22:42581992-42582014 GCGCCACCATCTTGCCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141815 Original CRISPR GCAGGACGAAGCTCGCGGCG CGG (reversed) Intergenic