ID: 1184141815

View in Genome Browser
Species Human (GRCh38)
Location 22:42581969-42581991
Sequence GCAGGACGAAGCTCGCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141815_1184141818 -1 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141818 22:42581991-42582013 CGCGCCACCATCTTGCCACCCGG No data
1184141815_1184141822 7 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141822 22:42581999-42582021 CATCTTGCCACCCGGGAGCGCGG No data
1184141815_1184141824 9 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141824 22:42582001-42582023 TCTTGCCACCCGGGAGCGCGGGG No data
1184141815_1184141823 8 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141823 22:42582000-42582022 ATCTTGCCACCCGGGAGCGCGGG No data
1184141815_1184141825 10 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141825 22:42582002-42582024 CTTGCCACCCGGGAGCGCGGGGG No data
1184141815_1184141819 0 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141819 22:42581992-42582014 GCGCCACCATCTTGCCACCCGGG No data
1184141815_1184141831 26 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141831 22:42582018-42582040 GCGGGGGTCGCCGGGAGTTGCGG 0: 1
1: 1
2: 3
3: 19
4: 240
1184141815_1184141830 18 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141830 22:42582010-42582032 CCGGGAGCGCGGGGGTCGCCGGG 0: 1
1: 1
2: 1
3: 37
4: 314
1184141815_1184141828 17 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141828 22:42582009-42582031 CCCGGGAGCGCGGGGGTCGCCGG 0: 1
1: 1
2: 2
3: 51
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141815 Original CRISPR GCAGGACGAAGCTCGCGGCG CGG (reversed) Intergenic
900357723 1:2272841-2272863 GGAGGGCGAGGCTCGGGGCGTGG - Intronic
901123555 1:6913522-6913544 GCAGGAGGAAGCTGGGGGCAGGG - Intronic
901235289 1:7664380-7664402 GCAGGAAGAAGCTCGGGGAGGGG - Exonic
924560470 1:245154091-245154113 GCAGGAAGAAACGGGCGGCGGGG + Intergenic
1066200531 10:33139571-33139593 GCATGACGAAGCTGGAGACGGGG - Intergenic
1072780998 10:98251733-98251755 GCAGGACGAAGCACTCTGCTAGG + Intronic
1076264819 10:129101433-129101455 GCAGGCCGCAGCTCGCTGGGGGG - Intergenic
1080603931 11:33848299-33848321 GCAGGAGGAAGGTGGCGGGGAGG - Intergenic
1084636766 11:70398320-70398342 GCAGCACACAGCCCGCGGCGGGG - Intergenic
1088868967 11:113875462-113875484 GCAGGACGACGCGGCCGGCGCGG - Exonic
1096773994 12:53953176-53953198 GCAGTTCGAAGCTCGCAGCTCGG - Intergenic
1105698520 13:22915477-22915499 GGAGGAGGAAGATGGCGGCGGGG + Intergenic
1122707186 14:103628925-103628947 GCAGGGCGCGGCTCGCGGGGTGG - Intronic
1132498728 16:275616-275638 CCAGGCCGCAGCTGGCGGCGGGG + Intronic
1133241428 16:4416448-4416470 GCCGGACTCACCTCGCGGCGGGG + Exonic
1136541551 16:30930249-30930271 TGAGGACGAAGCCCCCGGCGAGG + Exonic
1142105289 16:88299228-88299250 GGAGGAGGCAGCTTGCGGCGGGG + Intergenic
1158530624 18:58256593-58256615 GCAGGACGAACTCCGCGGAGAGG + Intronic
1162031849 19:7920878-7920900 GCAGGACGAGCCTGGGGGCGGGG + Intronic
1162924459 19:13923306-13923328 GGAGGACGAGGCTGGTGGCGGGG - Intronic
1163138736 19:15332225-15332247 GCTGGCGGAGGCTCGCGGCGCGG - Intronic
1163842240 19:19618560-19618582 GCAGGACGTCGCTCGTGTCGAGG + Exonic
1166561244 19:43733704-43733726 GCAGAACAAAGCTCGCCGAGAGG - Exonic
1167258412 19:48444053-48444075 GCAGGACGCTGCTCCAGGCGGGG - Exonic
1168076627 19:53983803-53983825 GCAGGAAGGAGCTTGCAGCGAGG + Exonic
925009112 2:468490-468512 GCAGGACGCAGCGGGGGGCGGGG + Intergenic
927713895 2:25341098-25341120 GCCGGAGGAGGATCGCGGCGCGG + Intronic
936006896 2:108897104-108897126 TCAGGCCGAAGCTCTCGGCGAGG + Exonic
942890303 2:180980406-180980428 CCAGGACAAAGAGCGCGGCGGGG - Intronic
1176107321 20:63395596-63395618 GCAGGACGCAGCTCCAGGCAGGG + Intergenic
1184037797 22:41926692-41926714 GCAGGTCGAAGCACTCGGCCGGG + Exonic
1184131596 22:42519754-42519776 GCAGGAGGAAGTGCGCCGCGCGG - Exonic
1184141815 22:42581969-42581991 GCAGGACGAAGCTCGCGGCGCGG - Intergenic
1185117308 22:48945153-48945175 GCAGGACCCAGCTGGCGGCTGGG + Intergenic
1185320518 22:50198441-50198463 ACAGGACCAGGCTCGCGGTGCGG - Exonic
959335260 3:105056858-105056880 GCAGGAGGAAGCGAGCGGGGCGG - Intergenic
966913907 3:184574614-184574636 GCAGCATGAAGCTGGCTGCGAGG + Intronic
969669408 4:8581510-8581532 GCAGCACGAAGCCCACGGCATGG - Exonic
976387856 4:84481684-84481706 GCAGGTGGAAGGGCGCGGCGCGG - Intergenic
985712638 5:1438312-1438334 TCAGAACGAAGCTGGCGGCATGG + Intronic
992473139 5:77077344-77077366 GCAGGAGGAAGAGCGCGCCGCGG - Exonic
1002045182 5:176537417-176537439 TCAGGGCGGAGCTCCCGGCGCGG - Exonic
1006517016 6:34550761-34550783 GCAGGTGGAAGCTGGGGGCGGGG + Intronic
1008932475 6:56954954-56954976 GCAGGACGATGCGCGGGGCCCGG - Intergenic
1014116758 6:117675495-117675517 GGAGGAGGAAGATGGCGGCGGGG + Exonic
1019287907 7:232794-232816 GCAGGACGGGGCACCCGGCGTGG + Intronic
1027230065 7:76267465-76267487 GCACGGCGCAGCCCGCGGCGCGG - Intronic
1029259784 7:99294014-99294036 GCAGGAGGAAGCTGGCCGCCAGG + Intergenic
1030159253 7:106490766-106490788 GCAGAACGAAGCTTGGGGCCAGG + Intergenic
1034147025 7:148883491-148883513 GCGGGACGACGTTCGCGGCGGGG - Intronic
1034522507 7:151631949-151631971 GCAGGACGCAGCTCGCCGTGGGG + Intronic
1042215276 8:66424960-66424982 GCAGGAGGAAGATGGCTGCGTGG + Intergenic
1043573557 8:81631181-81631203 TCAGGGCGCAGCTCGGGGCGGGG - Intergenic
1043578569 8:81686391-81686413 GCAGGGCGCAGCTCGGGGCGGGG - Intronic
1049521903 8:143095611-143095633 GCAGGAGAAAGCTGGGGGCGAGG - Intergenic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1059314138 9:113410071-113410093 GCACGAAGACGCTGGCGGCGCGG + Exonic
1059423948 9:114209356-114209378 GCAGAAGGAAGCTCGCGGCTGGG - Intronic
1061995226 9:134179812-134179834 ACAGGACGAAGCTGGTGGAGGGG + Intergenic
1062397592 9:136358682-136358704 CCAGGACGAAGCTGGAGGGGTGG - Exonic
1196116624 X:112005959-112005981 GCAGGGGGAAGGTGGCGGCGGGG + Intronic
1199612606 X:149631283-149631305 GCAGGACGGGGCTCGCGGCCGGG + Intronic