ID: 1184141820

View in Genome Browser
Species Human (GRCh38)
Location 22:42581995-42582017
Sequence GCTCCCGGGTGGCAAGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141820_1184141836 30 Left 1184141820 22:42581995-42582017 CCACCATCTTGCCACCCGGGAGC No data
Right 1184141836 22:42582048-42582070 CCGGCGCGAGCGCGTTTTTGTGG No data
1184141820_1184141828 -9 Left 1184141820 22:42581995-42582017 CCACCATCTTGCCACCCGGGAGC No data
Right 1184141828 22:42582009-42582031 CCCGGGAGCGCGGGGGTCGCCGG 0: 1
1: 1
2: 2
3: 51
4: 384
1184141820_1184141834 11 Left 1184141820 22:42581995-42582017 CCACCATCTTGCCACCCGGGAGC No data
Right 1184141834 22:42582029-42582051 CGGGAGTTGCGGTTCGGCGCCGG No data
1184141820_1184141832 5 Left 1184141820 22:42581995-42582017 CCACCATCTTGCCACCCGGGAGC No data
Right 1184141832 22:42582023-42582045 GGTCGCCGGGAGTTGCGGTTCGG 0: 1
1: 1
2: 0
3: 4
4: 61
1184141820_1184141831 0 Left 1184141820 22:42581995-42582017 CCACCATCTTGCCACCCGGGAGC No data
Right 1184141831 22:42582018-42582040 GCGGGGGTCGCCGGGAGTTGCGG 0: 1
1: 1
2: 3
3: 19
4: 240
1184141820_1184141830 -8 Left 1184141820 22:42581995-42582017 CCACCATCTTGCCACCCGGGAGC No data
Right 1184141830 22:42582010-42582032 CCGGGAGCGCGGGGGTCGCCGGG 0: 1
1: 1
2: 1
3: 37
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141820 Original CRISPR GCTCCCGGGTGGCAAGATGG TGG (reversed) Intergenic