ID: 1184141821

View in Genome Browser
Species Human (GRCh38)
Location 22:42581998-42582020
Sequence CGCGCTCCCGGGTGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141821_1184141834 8 Left 1184141821 22:42581998-42582020 CCATCTTGCCACCCGGGAGCGCG No data
Right 1184141834 22:42582029-42582051 CGGGAGTTGCGGTTCGGCGCCGG No data
1184141821_1184141832 2 Left 1184141821 22:42581998-42582020 CCATCTTGCCACCCGGGAGCGCG No data
Right 1184141832 22:42582023-42582045 GGTCGCCGGGAGTTGCGGTTCGG 0: 1
1: 1
2: 0
3: 4
4: 61
1184141821_1184141831 -3 Left 1184141821 22:42581998-42582020 CCATCTTGCCACCCGGGAGCGCG No data
Right 1184141831 22:42582018-42582040 GCGGGGGTCGCCGGGAGTTGCGG 0: 1
1: 1
2: 3
3: 19
4: 240
1184141821_1184141836 27 Left 1184141821 22:42581998-42582020 CCATCTTGCCACCCGGGAGCGCG No data
Right 1184141836 22:42582048-42582070 CCGGCGCGAGCGCGTTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141821 Original CRISPR CGCGCTCCCGGGTGGCAAGA TGG (reversed) Intergenic