ID: 1184141824

View in Genome Browser
Species Human (GRCh38)
Location 22:42582001-42582023
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141814_1184141824 10 Left 1184141814 22:42581968-42581990 CCCGCGCCGCGAGCTTCGTCCTG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1184141824 22:42582001-42582023 TCTTGCCACCCGGGAGCGCGGGG No data
1184141817_1184141824 -9 Left 1184141817 22:42581987-42582009 CCTGCGCGCCACCATCTTGCCAC No data
Right 1184141824 22:42582001-42582023 TCTTGCCACCCGGGAGCGCGGGG No data
1184141812_1184141824 19 Left 1184141812 22:42581959-42581981 CCTCCGGGTCCCGCGCCGCGAGC 0: 1
1: 0
2: 2
3: 21
4: 186
Right 1184141824 22:42582001-42582023 TCTTGCCACCCGGGAGCGCGGGG No data
1184141816_1184141824 4 Left 1184141816 22:42581974-42581996 CCGCGAGCTTCGTCCTGCGCGCC 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1184141824 22:42582001-42582023 TCTTGCCACCCGGGAGCGCGGGG No data
1184141813_1184141824 16 Left 1184141813 22:42581962-42581984 CCGGGTCCCGCGCCGCGAGCTTC 0: 1
1: 0
2: 2
3: 8
4: 104
Right 1184141824 22:42582001-42582023 TCTTGCCACCCGGGAGCGCGGGG No data
1184141811_1184141824 23 Left 1184141811 22:42581955-42581977 CCGTCCTCCGGGTCCCGCGCCGC 0: 1
1: 0
2: 0
3: 18
4: 234
Right 1184141824 22:42582001-42582023 TCTTGCCACCCGGGAGCGCGGGG No data
1184141815_1184141824 9 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141824 22:42582001-42582023 TCTTGCCACCCGGGAGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141824 Original CRISPR TCTTGCCACCCGGGAGCGCG GGG Intergenic