ID: 1184141831

View in Genome Browser
Species Human (GRCh38)
Location 22:42582018-42582040
Sequence GCGGGGGTCGCCGGGAGTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141820_1184141831 0 Left 1184141820 22:42581995-42582017 CCACCATCTTGCCACCCGGGAGC No data
Right 1184141831 22:42582018-42582040 GCGGGGGTCGCCGGGAGTTGCGG 0: 1
1: 1
2: 3
3: 19
4: 240
1184141821_1184141831 -3 Left 1184141821 22:42581998-42582020 CCATCTTGCCACCCGGGAGCGCG No data
Right 1184141831 22:42582018-42582040 GCGGGGGTCGCCGGGAGTTGCGG 0: 1
1: 1
2: 3
3: 19
4: 240
1184141815_1184141831 26 Left 1184141815 22:42581969-42581991 CCGCGCCGCGAGCTTCGTCCTGC 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1184141831 22:42582018-42582040 GCGGGGGTCGCCGGGAGTTGCGG 0: 1
1: 1
2: 3
3: 19
4: 240
1184141817_1184141831 8 Left 1184141817 22:42581987-42582009 CCTGCGCGCCACCATCTTGCCAC No data
Right 1184141831 22:42582018-42582040 GCGGGGGTCGCCGGGAGTTGCGG 0: 1
1: 1
2: 3
3: 19
4: 240
1184141816_1184141831 21 Left 1184141816 22:42581974-42581996 CCGCGAGCTTCGTCCTGCGCGCC 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1184141831 22:42582018-42582040 GCGGGGGTCGCCGGGAGTTGCGG 0: 1
1: 1
2: 3
3: 19
4: 240
1184141814_1184141831 27 Left 1184141814 22:42581968-42581990 CCCGCGCCGCGAGCTTCGTCCTG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1184141831 22:42582018-42582040 GCGGGGGTCGCCGGGAGTTGCGG 0: 1
1: 1
2: 3
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141831 Original CRISPR GCGGGGGTCGCCGGGAGTTG CGG Intergenic