ID: 1184141834

View in Genome Browser
Species Human (GRCh38)
Location 22:42582029-42582051
Sequence CGGGAGTTGCGGTTCGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141827_1184141834 -3 Left 1184141827 22:42582009-42582031 CCCGGGAGCGCGGGGGTCGCCGG 0: 1
1: 1
2: 4
3: 34
4: 229
Right 1184141834 22:42582029-42582051 CGGGAGTTGCGGTTCGGCGCCGG No data
1184141826_1184141834 0 Left 1184141826 22:42582006-42582028 CCACCCGGGAGCGCGGGGGTCGC 0: 1
1: 1
2: 1
3: 12
4: 141
Right 1184141834 22:42582029-42582051 CGGGAGTTGCGGTTCGGCGCCGG No data
1184141820_1184141834 11 Left 1184141820 22:42581995-42582017 CCACCATCTTGCCACCCGGGAGC No data
Right 1184141834 22:42582029-42582051 CGGGAGTTGCGGTTCGGCGCCGG No data
1184141821_1184141834 8 Left 1184141821 22:42581998-42582020 CCATCTTGCCACCCGGGAGCGCG No data
Right 1184141834 22:42582029-42582051 CGGGAGTTGCGGTTCGGCGCCGG No data
1184141829_1184141834 -4 Left 1184141829 22:42582010-42582032 CCGGGAGCGCGGGGGTCGCCGGG 0: 1
1: 1
2: 2
3: 35
4: 281
Right 1184141834 22:42582029-42582051 CGGGAGTTGCGGTTCGGCGCCGG No data
1184141817_1184141834 19 Left 1184141817 22:42581987-42582009 CCTGCGCGCCACCATCTTGCCAC No data
Right 1184141834 22:42582029-42582051 CGGGAGTTGCGGTTCGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141834 Original CRISPR CGGGAGTTGCGGTTCGGCGC CGG Intergenic