ID: 1184141867

View in Genome Browser
Species Human (GRCh38)
Location 22:42582188-42582210
Sequence TTCGCACTCGTGACTGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141867_1184141872 14 Left 1184141867 22:42582188-42582210 CCCCGGCCAGTCACGAGTGCGAA No data
Right 1184141872 22:42582225-42582247 CATGCATTCACACGTTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141867 Original CRISPR TTCGCACTCGTGACTGGCCG GGG (reversed) Intergenic