ID: 1184141872

View in Genome Browser
Species Human (GRCh38)
Location 22:42582225-42582247
Sequence CATGCATTCACACGTTGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184141868_1184141872 13 Left 1184141868 22:42582189-42582211 CCCGGCCAGTCACGAGTGCGAAC No data
Right 1184141872 22:42582225-42582247 CATGCATTCACACGTTGAATAGG No data
1184141867_1184141872 14 Left 1184141867 22:42582188-42582210 CCCCGGCCAGTCACGAGTGCGAA No data
Right 1184141872 22:42582225-42582247 CATGCATTCACACGTTGAATAGG No data
1184141869_1184141872 12 Left 1184141869 22:42582190-42582212 CCGGCCAGTCACGAGTGCGAACT No data
Right 1184141872 22:42582225-42582247 CATGCATTCACACGTTGAATAGG No data
1184141870_1184141872 8 Left 1184141870 22:42582194-42582216 CCAGTCACGAGTGCGAACTCAGC No data
Right 1184141872 22:42582225-42582247 CATGCATTCACACGTTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184141872 Original CRISPR CATGCATTCACACGTTGAAT AGG Intergenic