ID: 1184142728

View in Genome Browser
Species Human (GRCh38)
Location 22:42587685-42587707
Sequence CTGGCTCCACAGATGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184142723_1184142728 -7 Left 1184142723 22:42587669-42587691 CCCACCACTGGCAGTTCTGGCTC 0: 1
1: 0
2: 0
3: 25
4: 217
Right 1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 291
1184142724_1184142728 -8 Left 1184142724 22:42587670-42587692 CCACCACTGGCAGTTCTGGCTCC 0: 1
1: 0
2: 0
3: 19
4: 225
Right 1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 291
1184142720_1184142728 14 Left 1184142720 22:42587648-42587670 CCATTATCAATGGTCAAAGCACC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 291
1184142719_1184142728 17 Left 1184142719 22:42587645-42587667 CCTCCATTATCAATGGTCAAAGC 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184142728 Original CRISPR CTGGCTCCACAGATGGAGAT GGG Intronic
901656910 1:10774633-10774655 CTGGCCCCACTGCTGGAGACTGG + Intronic
901717970 1:11172087-11172109 CTGCCTCCACACATTCAGATGGG - Intronic
902736214 1:18402965-18402987 CTGGCTTCACAAATGAAAATGGG + Intergenic
904400306 1:30252469-30252491 CCAGCTCCAGGGATGGAGATGGG - Intergenic
904690966 1:32292890-32292912 CTGACTCCTCAGGTGGAGTTCGG - Intronic
904876240 1:33656641-33656663 CTGCCTCCCCTGCTGGAGATGGG - Intronic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
906609934 1:47194435-47194457 CTTGCCCCACAGATAGAGAGTGG - Intergenic
907147751 1:52251699-52251721 CTGGCTTCACAGAAGGAGTTAGG + Intronic
908870920 1:68610718-68610740 CTGGCTTCACAGAATGAGTTGGG + Intergenic
910434373 1:87190390-87190412 ATGGCTCCTCAAGTGGAGATGGG + Intergenic
912161305 1:106987885-106987907 CTGGCTGCATAGATTGAGTTAGG - Intergenic
912526568 1:110287771-110287793 CTGGCTCCTCAGCTGGAGGCAGG + Intergenic
915631859 1:157159046-157159068 CCTGCTCCAGGGATGGAGATGGG - Intergenic
915751212 1:158212764-158212786 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
916611503 1:166396516-166396538 CTGGCTACAGAGATGTAGACAGG + Intergenic
917891100 1:179439168-179439190 CTGGGCCCACAGAAGGGGATAGG + Intronic
919110782 1:193216580-193216602 CTGGCTTCACAGAATGAGTTAGG - Intronic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
923347768 1:233072884-233072906 CTGGCCCCACAGAATGAGTTAGG + Intronic
1066067901 10:31775525-31775547 CCGACTCCACAGCGGGAGATGGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1068204667 10:53834727-53834749 CTGCCTCCATTGATGGATATGGG + Intronic
1069813773 10:71180651-71180673 CTGGCTGGACAGATGGATGTAGG - Intergenic
1070721711 10:78761471-78761493 CTGGCTCCAGAGAGGGAGACAGG + Intergenic
1071199486 10:83203020-83203042 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1071474632 10:86015552-86015574 CTTCCTCCACAGCTGGACATTGG - Intronic
1073553887 10:104429116-104429138 TTGGCCCCACAGTAGGAGATTGG + Intronic
1076429679 10:130393028-130393050 CTGGCTACACAGATGTACTTGGG - Intergenic
1077564752 11:3290506-3290528 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1077570642 11:3336323-3336345 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1077852891 11:6092093-6092115 CTGGCCCCATAGATTGAGTTGGG + Intergenic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1078866434 11:15302357-15302379 CAGGATCCAGAGATGGGGATGGG - Intergenic
1079017505 11:16881676-16881698 CTGACTCCAGAGCTGTAGATAGG - Intronic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1079250890 11:18786764-18786786 ATGGATCTACAGGTGGAGATGGG - Intronic
1079398013 11:20082722-20082744 CTGGCTCAGCAGATGGATGTTGG - Intronic
1080216939 11:29854448-29854470 CTGGCTCCACAGAATGAGTTAGG - Intergenic
1080754246 11:35180317-35180339 TTTGCTGCACAGATGGAGTTGGG - Exonic
1082268734 11:50146510-50146532 CTTGCTCTACAGATGTAGACTGG + Intergenic
1083016972 11:59464213-59464235 CTGGCTTCATAGATTGAGTTAGG - Intergenic
1083336443 11:61924475-61924497 CTGGCCCCAGAGCAGGAGATGGG - Intergenic
1083353963 11:62051545-62051567 CTGGGTCCATAGATGGGGGTAGG + Intergenic
1084774793 11:71368260-71368282 CTGGCTACACAGCTGGCGAGGGG - Intergenic
1084815240 11:71641921-71641943 CTTGGTCCACAGAGGGAAATGGG + Intergenic
1084991044 11:72925939-72925961 TTGGATCCACAGCTGCAGATTGG - Intronic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085046578 11:73357013-73357035 TGGGCTCCACAGAAGGCGATCGG + Exonic
1085537544 11:77232419-77232441 CTCCCTCCACAGATAGTGATAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086478795 11:87210651-87210673 CTGGCTTCACAGAGTGAGTTAGG - Intronic
1088395909 11:109369338-109369360 CTGGCTTCACAGAATGAGCTAGG + Intergenic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1088807291 11:113364213-113364235 CTGCCTTCACAGAAGGAGAGGGG + Intronic
1089361955 11:117896780-117896802 CTGGCTCCACAGGTGTATGTTGG + Intergenic
1089538488 11:119175034-119175056 CTGGCTCCACACATGGGGCCAGG - Exonic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1093179885 12:15954716-15954738 CTGGCACCACTGTTGGAGAGGGG - Intronic
1094538946 12:31346994-31347016 CTGGCTCTCCAGATCCAGATTGG + Intergenic
1096242154 12:49965303-49965325 CTGGCTGCACAGTTAGAGAGGGG + Exonic
1103175809 12:118862235-118862257 CTGGCTCCATATCTGCAGATAGG - Intergenic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1105481840 13:20785268-20785290 CTGGCTCCATGGTTGGGGATTGG - Intronic
1106462652 13:29986317-29986339 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1107967856 13:45613705-45613727 CTGGTTCCACATTTGGAGTTTGG + Intronic
1107980093 13:45727078-45727100 CTGCTTCCACACATGGAGAAAGG + Intergenic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1109426127 13:62168009-62168031 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
1110742440 13:79013596-79013618 CTGGCTTCACAGAATGAGATAGG + Intergenic
1110788414 13:79560532-79560554 ATGGCTCCACCCATGGAGAATGG + Intergenic
1110925456 13:81145474-81145496 CTGTCTCCAGAGTTGCAGATGGG + Intergenic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1115947753 14:38682028-38682050 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1115963305 14:38860325-38860347 CTGGCTCCACAGAATGAGTTAGG + Intergenic
1116192904 14:41682944-41682966 CTGGCCTCACAGAAGGAGTTTGG - Intronic
1116724711 14:48548102-48548124 CTGGCTTCACAGAAAGAGAGAGG - Intergenic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117478828 14:56122668-56122690 TAGGGTCCACAGATGGAGTTCGG + Intronic
1117651521 14:57911783-57911805 CTGGCTTCACAGAATGAGTTAGG + Intronic
1122426505 14:101610758-101610780 CTGGCTTCACAGAATGAGTTAGG - Intergenic
1122783810 14:104154860-104154882 GTGCCTCCATACATGGAGATTGG + Intronic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1123974251 15:25537774-25537796 CTGGCTCTAAAGACAGAGATGGG - Intergenic
1123978992 15:25581741-25581763 CTGGCTTCATAGATTGAGTTGGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1126250401 15:46561203-46561225 CTGACTCCACAGAATGAGTTTGG + Intergenic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1128847769 15:70916868-70916890 CTGGGTCCACAGCTGCAGTTTGG - Intronic
1129046310 15:72737509-72737531 CTGGCTCCAGAGGAAGAGATGGG - Exonic
1129352241 15:74962858-74962880 CTGGCCCCACAGATGGGGAATGG + Intronic
1129743327 15:78000863-78000885 GTGGTCCCACAGATGGAGAAGGG - Intronic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1130849115 15:87776676-87776698 CTGGGTCTACAGAAGCAGATAGG + Intergenic
1132901315 16:2256207-2256229 CTGCCTCGACACGTGGAGATTGG - Intronic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133481263 16:6172979-6173001 CTGGCTTCGAAGATGGAGAAAGG - Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1138194076 16:55039853-55039875 CTGATTCCACAGATGTAGAGGGG - Intergenic
1139183024 16:64770275-64770297 CTGGGTCCACAGGTGCAGTTTGG - Intergenic
1140193262 16:72836169-72836191 GTGGCTACACCGATGGAGGTGGG + Intronic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1142140849 16:88472098-88472120 CTGGGTCCACAGATGGGGTGGGG - Intronic
1142899188 17:3001921-3001943 CTAGCACCACAGCTGGAGGTGGG - Intronic
1143390698 17:6557472-6557494 CTGGCTCTACAGATGGTAACTGG - Intergenic
1146660058 17:34659700-34659722 CTCCCTGGACAGATGGAGATGGG - Intergenic
1151494392 17:74450735-74450757 CTGGCACCAAAGACAGAGATGGG + Intronic
1157045332 18:44095960-44095982 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1157172714 18:45422700-45422722 CTGGCTCCATTGATGGAGCAGGG - Intronic
1160031940 18:75269556-75269578 CTGACTCCACAGAGGGAGCCTGG + Intronic
1161847072 19:6718236-6718258 CTGGCTCCACAGGTGAGGCTGGG - Exonic
1163011445 19:14429084-14429106 CTGCCTCCCCAGATGGAGCTGGG - Intergenic
1163374439 19:16921737-16921759 CCAGCTCCAGAGATGGAGGTTGG - Intronic
1165167443 19:33866785-33866807 CCGGCTCCACAGATGGGCAAAGG + Intergenic
1165270884 19:34706483-34706505 TTGGCTCCACCCATGGAGCTGGG + Intergenic
1166438028 19:42786135-42786157 CTGGTTCCACAGCTTGTGATGGG - Intronic
1166464268 19:43018536-43018558 CAGGGTCCACAGATTGTGATGGG - Intronic
1166486735 19:43220413-43220435 CTGGTTCCACAGCTTGTGATGGG - Intronic
1166491135 19:43261627-43261649 CTGGGTCCACAGCTTGTGATGGG - Intronic
1167639282 19:50671767-50671789 CTGGCTCTACATCTGGAGAATGG - Intronic
1167763820 19:51466383-51466405 CTGGCCTCACAGAAGGATATAGG - Intergenic
1168388052 19:55982575-55982597 CTGACTCCACAGTTGGTGCTGGG + Intronic
1168440827 19:56365669-56365691 CTGCCTCCAAAGTTGGAGACAGG + Intronic
925146206 2:1584858-1584880 CCGGCTGCGCAAATGGAGATAGG + Intergenic
926224549 2:10957739-10957761 CTGGCCCCACAAACGGACATGGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927098251 2:19764444-19764466 CTGGAGCCCCAGATGGACATGGG + Intergenic
927252017 2:21004383-21004405 CTGGTAGCGCAGATGGAGATCGG + Exonic
928206690 2:29289685-29289707 CAGGCTCCAAAGTTGGAAATGGG - Intronic
930798465 2:55418952-55418974 GTGGCTGCAGAGATGGAGGTGGG - Intronic
931175194 2:59847367-59847389 CTGATTCCACAGCTGGAAATTGG - Intergenic
933278344 2:80305373-80305395 CAGGCTCCACAGATACATATGGG + Intronic
937113823 2:119389006-119389028 CTGGCTCCATAGAATGAGATAGG - Intergenic
937519737 2:122697741-122697763 CTGGCTTTGAAGATGGAGATAGG - Intergenic
937732927 2:125256936-125256958 CTGGCTTCACAGAATGAGTTGGG - Intergenic
938225316 2:129610944-129610966 AGGGCTCCACAGATGGTGGTGGG - Intergenic
939073293 2:137569124-137569146 CTGCCTCCGGAGATGGAGAAAGG + Intronic
947123645 2:226843776-226843798 CTGGCTTCATAGAAGGAGTTGGG + Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1169362253 20:4960994-4961016 CTGCCTCCAGAGATGGAAACTGG + Intronic
1170300427 20:14877978-14878000 CTGGCTCCATAGAAGGAGTTAGG + Intronic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1171105402 20:22428482-22428504 CTGGCTCCACTATTAGAGATGGG - Intergenic
1173530616 20:43766680-43766702 TTGACTCCACAAATAGAGATCGG - Intergenic
1174939340 20:54907289-54907311 CTGGCTTCACAGAATGAGTTTGG - Intergenic
1175317900 20:58064549-58064571 CTTGTTCCACAGTTGGGGATCGG + Intergenic
1178046749 21:28703363-28703385 CTGGCTGGACAGATGGGGAGGGG + Intergenic
1181389929 22:22572982-22573004 GTGACTCCAAAGATGGACATTGG + Intergenic
1182035712 22:27196709-27196731 CTGGCTCCTCAGTTGCAGAGAGG - Intergenic
1183646835 22:39131965-39131987 AGGGCTCCACAGCTGGAGATGGG + Exonic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
1184249409 22:43251593-43251615 CTGGCTCTGCAGGTGGAGAAGGG + Intronic
1184804965 22:46788883-46788905 CTCACTCCACAGAGGAAGATTGG - Intronic
1184959480 22:47918602-47918624 CTGGCCCCACAGATGGTGACTGG + Intergenic
949563137 3:5221081-5221103 CTTGCTCCACAGATGGCAAAGGG - Intergenic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952253522 3:31676542-31676564 TTGGTTCCTCAGATTGAGATTGG - Intronic
953671649 3:44967872-44967894 CTGGCTACAGCAATGGAGATGGG + Intronic
953678261 3:45020195-45020217 CTGGATACACAGTTGTAGATAGG - Intronic
954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG + Exonic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
955538172 3:59947017-59947039 CTGGCCTCACAGAAGGAGTTAGG + Intronic
957072467 3:75577815-75577837 CTTGGTCCACAGAGGGAAATGGG - Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
959749356 3:109814778-109814800 CTGGCACCACAAAGGGAGAAAGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
963764781 3:149323361-149323383 CTGGCAGCTGAGATGGAGATAGG - Intronic
964708445 3:159646184-159646206 ATGGCTCCATAGGTGGAGAGTGG - Intronic
964821529 3:160775637-160775659 CTGGCTCCTCAGAGGAAGCTAGG + Intronic
964873738 3:161342287-161342309 CTGGCTCCAAAGAGGGAAAAAGG - Intergenic
965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG + Intronic
966475648 3:180342407-180342429 CTTACCCCACAGATGGAGAAGGG - Intergenic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
969004637 4:4009488-4009510 GTAGCCCCACAGATGGAGTTGGG + Intergenic
969257684 4:6013710-6013732 CTGGGTCCAAAGATGGAGGCGGG + Intergenic
969258021 4:6015777-6015799 CTGGCTCCAAAGATGAAGGCAGG - Intergenic
969538089 4:7768950-7768972 CTGGTGTCACAGCTGGAGATGGG + Exonic
969581996 4:8071146-8071168 CTGCCCCCACAGAGGGAGCTGGG - Intronic
969664270 4:8548123-8548145 TAGGCCCCACACATGGAGATGGG + Intergenic
969688452 4:8689967-8689989 CTGGCTGCACAGGTGGAGTCTGG + Intergenic
969708252 4:8826294-8826316 CTGGCTTCAAAGAATGAGATGGG - Intergenic
969737891 4:9003219-9003241 CTTGGTCCACAGAGGGAAATGGG + Intergenic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
970734804 4:19153305-19153327 CTGGCTTCACAGAATGAGTTAGG + Intergenic
971362573 4:25951390-25951412 CTGCCTCCAGACATGGAGGTGGG - Intergenic
971933110 4:33111491-33111513 CTGGCTTCACAGAATGAGTTAGG + Intergenic
972143543 4:35992032-35992054 CTGGCTCCATAGAATGAGTTTGG - Intronic
972994820 4:44867359-44867381 CTGGCTTCACAGAAAGAGTTAGG + Intergenic
973149372 4:46867880-46867902 CTGGCTTCACAGAAAGAGTTGGG + Intronic
974376082 4:61077901-61077923 CTGGCTTCACAGAATGAGTTAGG - Intergenic
975737323 4:77394012-77394034 CTGGGTCCACAGAGGTGGATAGG + Intronic
976563284 4:86526073-86526095 CTGGCTTCACAGAGTAAGATAGG + Intronic
979061663 4:116069168-116069190 CTGGCTTCACAGAATGACATAGG - Intergenic
980586181 4:134818293-134818315 CTGGCTTCATAGATTGAGTTAGG - Intergenic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
983491788 4:168398080-168398102 CTGGGTCCACAGTTGCAGCTTGG - Intronic
984279334 4:177650141-177650163 CAGGGTTCACAGATGGACATAGG - Intergenic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
985408107 4:189656289-189656311 TTGGCTCCAGAGATGGTGGTGGG + Intergenic
986251613 5:6063628-6063650 CTGGCTCCATAGAATGAGCTAGG - Intergenic
986378227 5:7155493-7155515 CTGGCTCCACAGAGTGAATTAGG + Intergenic
987611755 5:20213385-20213407 CTGGCCTCACAGAAGGAGTTAGG + Intronic
987697109 5:21345940-21345962 CTGGCTTCACAGAATGAGTTAGG + Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
990449991 5:55924960-55924982 CTGGCTCCGCAGACGGAGGAAGG - Intergenic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992726241 5:79610392-79610414 CTGGCCCCACAGAATGAGCTGGG + Intergenic
994048273 5:95333230-95333252 TTGGCTCTACAGATGGAGGAAGG + Intergenic
995722860 5:115154820-115154842 CTGGCTTCACAGAATGAGTTAGG - Intronic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996265804 5:121538264-121538286 CTGGCTTCACAGAATGAGTTAGG - Intergenic
997346459 5:133195939-133195961 TTGTCTGGACAGATGGAGATGGG + Intergenic
997941891 5:138165373-138165395 AGGGCTACAAAGATGGAGATGGG + Intronic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
999287015 5:150400130-150400152 CTTGCTCCACAGATCCAGCTAGG + Exonic
1000052355 5:157574627-157574649 CTGGCTCCACCGCTGCAGACGGG - Intronic
1000400376 5:160820527-160820549 CTGGCTTCACAGAATGAGTTTGG - Intronic
1000857461 5:166417164-166417186 ATGGCTATATAGATGGAGATGGG - Intergenic
1001417235 5:171554696-171554718 ATGGCTCCCCAGTTGGAGAAAGG - Intergenic
1001673671 5:173494678-173494700 TTGGCTACACGGATGGACATGGG - Intergenic
1002280674 5:178128353-178128375 CTGGCCCCAAAGAGGGTGATGGG + Intergenic
1002600512 5:180352022-180352044 GTGGCTCTACACATGGAGAATGG + Intronic
1003274955 6:4642239-4642261 CTGGTTCCACTGATGGATGTGGG - Intergenic
1005553753 6:26952464-26952486 CTGGCTTCACAGAATGAGTTAGG - Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006228481 6:32561354-32561376 CGGGGTCCACAGAGGGGGATAGG + Intronic
1006274632 6:32993030-32993052 CTGGCTTCACAGAATGAGTTGGG + Intergenic
1007649840 6:43412649-43412671 CTGGGTCCACAGCTGGGGTTGGG - Intergenic
1008315437 6:50033817-50033839 CTGGCTTCACAGAATGAGGTAGG - Intergenic
1010294253 6:74177644-74177666 CTGGCTGCATATATGGAGCTGGG - Intergenic
1011062310 6:83284379-83284401 CTGGCTTCACAGAATGAGTTAGG - Intronic
1011224067 6:85087551-85087573 CTGGCTCCTTAGATGGTGAAAGG - Intergenic
1012290083 6:97443630-97443652 CTGGCTCCCCAGATGTAGCATGG + Intergenic
1012599222 6:101073554-101073576 CTGGCAAGTCAGATGGAGATAGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1016230117 6:141793150-141793172 CTGGCCCCATAGAAGGAGTTTGG - Intergenic
1017352223 6:153455905-153455927 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1018162101 6:161054896-161054918 CTGGGTCCACAAATGGATATGGG - Intronic
1019518842 7:1451612-1451634 CTGGCCCCACAGAGGGAGCTGGG + Intronic
1020463951 7:8455401-8455423 ATGGCACCACAGATGAAAATAGG - Intronic
1020871341 7:13632943-13632965 CTGGCTTCATAGAATGAGATAGG - Intergenic
1023290475 7:38663496-38663518 CTGGCTTCATAGAAGGAGTTAGG - Intergenic
1024274278 7:47665243-47665265 CTTGAGCCACAGATGGTGATTGG - Intergenic
1024726185 7:52198584-52198606 CTGGTTCCATAGATTGAGTTAGG + Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1030532608 7:110729484-110729506 CTCCCTCAACACATGGAGATTGG + Intronic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1031089602 7:117338609-117338631 GTTGTTCCACAGATGAAGATTGG - Intergenic
1031892588 7:127311938-127311960 CTGGCCTCACAGAAGGAGTTTGG - Intergenic
1031910412 7:127511160-127511182 CTGGCTTTACACATGGAGAAAGG + Intergenic
1031920200 7:127594826-127594848 CTGGCTCCAGGGATGAAGATGGG - Intronic
1034756488 7:153626264-153626286 CTGGCTTCATAGAAGGAGTTAGG + Intergenic
1035593141 8:833480-833502 CTGGCTTTGCAGATGGAGGTGGG - Intergenic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1036966287 8:13301711-13301733 CAGGCTGCACAGCAGGAGATGGG + Intronic
1037131582 8:15413262-15413284 ACGGGTCCACAGATGGAGAGAGG - Intergenic
1037734711 8:21556710-21556732 CTGGGGCCACAGAAGCAGATGGG - Intergenic
1038682280 8:29679755-29679777 TTGGCTACATAGAGGGAGATGGG + Intergenic
1040543213 8:48377855-48377877 CTCCCTCCACCGATGGAGAAAGG - Intergenic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1042652482 8:71058447-71058469 CTGGCTCTGTAGATGGAGAGTGG - Intergenic
1045689617 8:104746812-104746834 CTGGCTTAACAGAGGGAGGTAGG + Intronic
1046421171 8:113984747-113984769 CTGGCTTCACAGAATGAGTTAGG - Intergenic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1047565911 8:126043381-126043403 CTGGCTACACAGAATGAGCTAGG + Intergenic
1047699907 8:127438531-127438553 CTGGCTTCACAGAATGAGTTAGG - Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1049066141 8:140316761-140316783 CTGGCTTCACAGAATGAGTTTGG + Intronic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1050891247 9:10827295-10827317 CTGGCTTCACAGAAGGATTTGGG + Intergenic
1051197664 9:14580794-14580816 CTGGCTCCATAGAATGAGTTAGG - Intergenic
1051436080 9:17033707-17033729 CTGGCACCTCAGAAGGAGAGTGG + Intergenic
1051891776 9:21949674-21949696 CTGGCCTCACAGAAGGAGTTGGG - Intronic
1052277879 9:26698846-26698868 CTGGCTCCATAGAATGAGTTAGG - Intergenic
1052955842 9:34252730-34252752 CTTGGTCCACAGACGGAGCTGGG - Exonic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1055518182 9:77054254-77054276 CTGACTCTAAAGAGGGAGATTGG - Intergenic
1058587833 9:106529840-106529862 CAGCCTCCACAGTAGGAGATGGG + Intergenic
1059668824 9:116474571-116474593 CCTCCTTCACAGATGGAGATGGG + Intronic
1059954353 9:119500282-119500304 CTGCCTCCTCTGATGGGGATGGG + Intronic
1061008058 9:127939443-127939465 CAGACTCCATAGTTGGAGATGGG - Intergenic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1186203785 X:7180487-7180509 CTGGCTGCACAGCAGGAGGTGGG - Intergenic
1186451417 X:9676967-9676989 TTCGCCCCACAGATGAAGATAGG + Intronic
1186621912 X:11250621-11250643 CCGGCTTCAAAGATGGAGAAAGG - Intronic
1188663841 X:32793880-32793902 CTGGCTTCATAGAATGAGATAGG - Intronic
1188713216 X:33428166-33428188 CTGTCCCCAGAGATGGAGAATGG - Intergenic
1188757654 X:33984045-33984067 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1192540524 X:71966796-71966818 CTGGCTTCACAGAATGAGTTAGG + Intergenic
1193546961 X:82843178-82843200 CTGGTTCCACAGATGTAGCCAGG - Intergenic
1194177541 X:90668934-90668956 CTGGCTACACAGAATGAGTTAGG - Intergenic
1195688332 X:107604459-107604481 ATGGCTCCAGAGAGGGAGAAAGG - Exonic
1196996645 X:121390709-121390731 CTGGGTCCAGAGATGAAGAATGG + Intergenic
1198030594 X:132750140-132750162 CTGGCCCCACAGATTGTGGTGGG - Intronic
1198082998 X:133256689-133256711 CTGGCTTCACAGAATGAGTTTGG - Intergenic
1199104302 X:143844083-143844105 CTGGCCCCATAGAATGAGATTGG + Intergenic
1199473995 X:148226137-148226159 CTGGTTCCTCAGATGGAGTTAGG + Intergenic
1199713221 X:150487031-150487053 CTGACTCCACAGATACAGGTGGG + Intronic
1200524212 Y:4251081-4251103 CTGGCTACACAGAATGAGTTAGG - Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic