ID: 1184143163

View in Genome Browser
Species Human (GRCh38)
Location 22:42591635-42591657
Sequence GCACTAAACAGATCAACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184143154_1184143163 30 Left 1184143154 22:42591582-42591604 CCAGGTGTCAACATTCAGACAAA 0: 1
1: 0
2: 3
3: 10
4: 163
Right 1184143163 22:42591635-42591657 GCACTAAACAGATCAACATCTGG 0: 1
1: 0
2: 0
3: 7
4: 74
1184143160_1184143163 4 Left 1184143160 22:42591608-42591630 CCAGGGCTGGGAGGAACTTCTGC 0: 1
1: 0
2: 3
3: 28
4: 291
Right 1184143163 22:42591635-42591657 GCACTAAACAGATCAACATCTGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184143163 Original CRISPR GCACTAAACAGATCAACATC TGG Intronic
901724399 1:11229459-11229481 GAACTAAACAGATGAAGAGCTGG + Intronic
906039428 1:42776522-42776544 TTACCAAACAGATCAGCATCAGG - Intronic
907554130 1:55329923-55329945 GCACTAAACAGATCATGAAGCGG - Intergenic
907997350 1:59646077-59646099 TCACTAAACAGATCCAGATGTGG + Intronic
915746872 1:158167951-158167973 GAACTAAGCAAATCAACATATGG + Intergenic
916554790 1:165884832-165884854 GCAGTAAACAGCTCATCAACAGG - Intronic
920372421 1:205487626-205487648 TCTCTAAAGAGATCAACATTTGG + Intergenic
920718643 1:208366242-208366264 ACACAAAACAGAACCACATCAGG - Intergenic
924287102 1:242498764-242498786 GCACTAAACTGATCCACATGTGG - Intronic
1064273422 10:13885436-13885458 GCACCACACAGATCCACATCAGG + Intronic
1065178355 10:23100301-23100323 GCACTAAAAAGAGCAAGAACAGG - Intronic
1073649238 10:105341137-105341159 GCACAAAACAGATCACCAGATGG + Intergenic
1080961481 11:37165942-37165964 GCACTAAACAAACCCACATCTGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082207961 11:49461690-49461712 GCACTCAACAGAGAAACATAGGG + Intergenic
1087669265 11:101085910-101085932 GCACTGAACAGACCAATATTGGG + Intronic
1090089088 11:123678505-123678527 GCACTAAGGAAATGAACATCTGG - Intergenic
1092701500 12:11236306-11236328 TCAATAAAGAGATAAACATCTGG + Intergenic
1099864008 12:88255819-88255841 GAAGAAAACACATCAACATCTGG - Intergenic
1105516204 13:21092995-21093017 GCAGTAAACAGCTGAACTTCTGG + Intergenic
1107226830 13:38060399-38060421 GCACTAAACAGATCACAAAGGGG + Intergenic
1111831701 13:93338401-93338423 GCACTAATCAGAACAAGATGTGG - Intronic
1112121510 13:96417190-96417212 TCACTAAACACACCAACAGCTGG - Intronic
1115759280 14:36561769-36561791 GAGCTAAAGAGATCAAGATCAGG + Intergenic
1118054175 14:62062210-62062232 GCAGAAAAAAGATCAACATCTGG - Intronic
1125140165 15:36396761-36396783 GCACTAAAGAGAGCAATTTCTGG + Intergenic
1128447099 15:67773328-67773350 GCACTAAACAAATGACCATTTGG - Intronic
1132912050 16:2319035-2319057 GCACCAAGCAGATGAACAACTGG + Intronic
1141395073 16:83697309-83697331 GCACTAAACAGATCACAAAAAGG - Intronic
1143291021 17:5829079-5829101 TCCCTACACAGATCATCATCTGG - Intronic
1149811595 17:59679198-59679220 GTAATACACAGTTCAACATCTGG - Intronic
1150099313 17:62408111-62408133 ACAATAAACAGATAAGCATCTGG - Intronic
1153532728 18:6065529-6065551 GCCCTGAACAGACCAACAACAGG - Intronic
1156427991 18:37037022-37037044 GCAGTAAAGAAAGCAACATCTGG + Intronic
930600185 2:53433705-53433727 GCACAATACAGACCATCATCAGG + Intergenic
932533484 2:72564946-72564968 GCACTAAGCAGAACAAAATCAGG + Intronic
933113723 2:78438717-78438739 GCACTGAACAGAAAAACATGTGG + Intergenic
940195827 2:151093021-151093043 GCAATACACAGAGCAACATTTGG + Intergenic
941017300 2:160371860-160371882 ACACTAAAAGGATCAACAACAGG + Intronic
943241890 2:185395817-185395839 GGAATAAATAGATCAAAATCAGG - Intergenic
945445063 2:209927080-209927102 GCATAAAACAGTTCAACATGTGG - Intronic
948341702 2:237257913-237257935 GCATTAAGCTGATCAACACCGGG + Intergenic
1172266509 20:33619742-33619764 GCAGTTAACAGATAAACGTCAGG + Intronic
1184143163 22:42591635-42591657 GCACTAAACAGATCAACATCTGG + Intronic
952636337 3:35537286-35537308 GCACTAAAGTGATCAAAACCTGG - Intergenic
960321269 3:116239635-116239657 GGACCAAACAGAACAACATTGGG + Intronic
960357311 3:116669548-116669570 GCACAAAACACTTCAACATGGGG - Intronic
964681049 3:159339118-159339140 GCACAAAACAGATGAAAACCTGG - Intronic
966351994 3:179040582-179040604 GCACTAAACATAGAAACAACCGG + Intronic
972010680 4:34177239-34177261 GCACTAATTAGAGCAACATGGGG - Intergenic
972180681 4:36461517-36461539 GCATTAAAGACATCAAGATCTGG - Intergenic
975699256 4:77046627-77046649 GAATTAAACAGATGAAGATCAGG + Intergenic
986128349 5:4904668-4904690 GCAGTAAACAGAAAAGCATCTGG - Intergenic
986887943 5:12263163-12263185 GCAGTAAACAATTCAACATATGG - Intergenic
999056560 5:148584321-148584343 GGACTAGACAGATGGACATCAGG + Intronic
999186178 5:149711348-149711370 ACTCTAAACAAATCAAGATCAGG - Intergenic
1001697263 5:173680454-173680476 GCATTAAACAGCTGATCATCAGG - Intergenic
1002109217 5:176896883-176896905 GCACTAAATAGAATAACACCTGG + Intronic
1012325401 6:97909975-97909997 GCACTAAAAATTTCAGCATCTGG + Intergenic
1012748796 6:103130341-103130363 GCAAGAAGCATATCAACATCTGG - Intergenic
1017141881 6:151198278-151198300 GCACTAACCAGAAAAAAATCAGG + Intergenic
1024949531 7:54844979-54845001 GAACAAAACAGATCAGCATCTGG + Intergenic
1032143384 7:129355178-129355200 GCACTAAACAGATTATGAACAGG - Intronic
1037478710 8:19283834-19283856 GCACTAGACAGATCATCAAGGGG - Intergenic
1043630435 8:82324333-82324355 GCATTAAACACTTCAACATAAGG - Intergenic
1044092566 8:88020438-88020460 TCAGTAAAGAGATCCACATCTGG + Intergenic
1046271270 8:111900835-111900857 GCACTAAACAGAAAATCATTAGG + Intergenic
1046694024 8:117318011-117318033 GCACTGCAGAGATCAACAACAGG - Intergenic
1050308741 9:4331776-4331798 GAAATAACCAGATGAACATCTGG + Intronic
1051352970 9:16215588-16215610 GCACAAAACAAATCAAAATATGG + Intronic
1053612735 9:39731808-39731830 GCACTAGAAAGATGAACATTAGG - Intergenic
1053870777 9:42489770-42489792 GCACTAGAAAGATGAACATTAGG - Intergenic
1054085518 9:60739347-60739369 GCACTAGAAAGATGAACATTAGG + Intergenic
1054240781 9:62610582-62610604 GCACTAGAAAGATGAACATTAGG + Intergenic
1054554915 9:66645106-66645128 GCACTAGAAAGATGAACATTAGG + Intergenic
1054593634 9:67039567-67039589 GAACTACACAGTTCAACAACAGG - Intergenic
1057039793 9:91839838-91839860 GTATTAAACAGATCACCCTCAGG - Intronic
1186655106 X:11604054-11604076 GCTCTAATCACAGCAACATCGGG + Intronic
1195754780 X:108190039-108190061 GCTCTAAACAGGTCAAGACCTGG - Intronic
1197454004 X:126654622-126654644 GCACTAAAGAGATCATAACCAGG - Intergenic
1197543148 X:127790764-127790786 GCACTAAACATAGGAACAACTGG + Intergenic
1201481373 Y:14443183-14443205 GCACTACACAGATCAATAACTGG + Intergenic