ID: 1184144322

View in Genome Browser
Species Human (GRCh38)
Location 22:42599930-42599952
Sequence ACTTGGGCCCCAGTCTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184144322_1184144326 6 Left 1184144322 22:42599930-42599952 CCTGGAAAGACTGGGGCCCAAGT 0: 1
1: 0
2: 0
3: 24
4: 206
Right 1184144326 22:42599959-42599981 AGGCTAACTCCCTGTCAGCAAGG 0: 1
1: 0
2: 1
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184144322 Original CRISPR ACTTGGGCCCCAGTCTTTCC AGG (reversed) Intronic
900394190 1:2446419-2446441 CCTGGGGCCCCAGTCTGTCAAGG - Intronic
901185415 1:7369663-7369685 CCTTGGTGCCCAGTCTTTACTGG + Intronic
902385062 1:16071783-16071805 ACCTGGGCCCCAGCCTCTCAGGG + Intronic
904266257 1:29319978-29320000 TCTGGGGCCCCAGGCTCTCCAGG - Intronic
911043856 1:93612754-93612776 ACTTGAGCCCCTTTCTGTCCTGG - Intronic
911337146 1:96594807-96594829 ACTTTGGTCCCTGTCTTTGCTGG - Intergenic
916119329 1:161513644-161513666 ACTTGGGCCACACTCTTTTCAGG - Intronic
916129091 1:161595303-161595325 ACTTGGGCCACACTCTTTTCAGG - Intronic
917981097 1:180269915-180269937 AGTTGGGCCACAGTAGTTCCGGG + Intronic
919808679 1:201396013-201396035 CCCTGGGCCCCAGCCTGTCCTGG - Intronic
920504965 1:206508858-206508880 ACTGGGGGCCCAGTGTTTTCTGG - Intronic
920682276 1:208082346-208082368 CCTCTAGCCCCAGTCTTTCCCGG + Intronic
920966650 1:210706654-210706676 AATTGGCTCCCAGTATTTCCTGG - Intronic
922478228 1:225921551-225921573 ACTCGGGGCCCAGGCTTTGCTGG - Exonic
922674197 1:227541095-227541117 ACATAGGCCCCTGACTTTCCTGG + Intergenic
923370900 1:233311321-233311343 ACTTGGGTCTCCATCTTTCCAGG - Intergenic
924392914 1:243582413-243582435 AATAGGTCCCCAGTCTCTCCTGG - Intronic
1064651950 10:17518556-17518578 AACTGGGCCCCAGTCTGTTCTGG + Intergenic
1065951121 10:30652095-30652117 CCTTCGGCTCCAGTCTTCCCAGG + Intergenic
1066034383 10:31467382-31467404 GCATGGGCCCCACTCTATCCTGG - Intronic
1067083746 10:43227555-43227577 CCCTGGGCCCCAGCCTTCCCAGG - Intronic
1069733370 10:70634090-70634112 ACTGGGGCCAGAGCCTTTCCTGG + Intergenic
1069903718 10:71720208-71720230 CCCTGGGCCCCATTCCTTCCAGG + Intronic
1070054464 10:72922003-72922025 TATTGGCCCCCAGTCTCTCCTGG + Intronic
1071505572 10:86229600-86229622 ACACAGGCCCCAGTCATTCCAGG + Intronic
1071888272 10:89974272-89974294 GCTGGGTCCCCAGTGTTTCCAGG + Intergenic
1073047239 10:100646819-100646841 CCTTGGGCCCAAGTGTGTCCAGG - Intergenic
1074243443 10:111662953-111662975 ACTTTGAGCCCAGCCTTTCCTGG - Intergenic
1075230625 10:120673063-120673085 TATTGGCCCCCAGTCTTTTCTGG - Intergenic
1075447166 10:122521126-122521148 AGTAGGGCCCCAGTCTTTTCAGG + Intergenic
1076171957 10:128326964-128326986 ACTTGGGCCCCAGTGGATACTGG + Intergenic
1076353134 10:129832417-129832439 TCCCTGGCCCCAGTCTTTCCAGG + Intergenic
1078609344 11:12806567-12806589 ACTTGGGCCCTAGACTTTAGAGG - Intronic
1080752228 11:35161360-35161382 ACTTGGACCCAAGTCTTTCTTGG + Intronic
1081590531 11:44419780-44419802 ACCTGAGACTCAGTCTTTCCAGG + Intergenic
1081992742 11:47346521-47346543 CCTTGGCCCCCAGTCCTGCCTGG - Intronic
1083073293 11:60009919-60009941 TATTGGCCCCCACTCTTTCCTGG + Intergenic
1083172615 11:60931906-60931928 ACTTGGCCTCCAGCCTTCCCAGG - Intronic
1083188209 11:61030447-61030469 ACTGGGCCCACAGTCTTTCACGG + Intergenic
1083400277 11:62418681-62418703 ACTTGGGCCTCAGTTTCTCCAGG + Intronic
1083428637 11:62602375-62602397 ACTAGGGGCCGACTCTTTCCTGG - Exonic
1083993001 11:66258099-66258121 ACGCGGCCCCCAGTCCTTCCAGG - Intronic
1084001349 11:66296765-66296787 AATTGGGCTCCAGTGTTCCCAGG + Intergenic
1085512562 11:77095720-77095742 GCTTGGGCCCAAGTGGTTCCTGG + Intronic
1085657865 11:78333134-78333156 AATTGGAGCCCAGTATTTCCGGG - Intronic
1089840510 11:121413458-121413480 ACTTGCGCCCGTGGCTTTCCGGG - Intergenic
1090538339 11:127671572-127671594 ACTGGGGCACCACTGTTTCCAGG - Intergenic
1093134953 12:15439098-15439120 AATAGGCCCCCAGTCTCTCCTGG - Intronic
1093522688 12:20068596-20068618 TATTGGACCCCAGTCTTTTCTGG - Intergenic
1094285808 12:28792185-28792207 ACTTGGGCCCCAGTCCTAGGAGG - Intergenic
1094375680 12:29784769-29784791 ACTTGGGTCTCATTATTTCCTGG + Intergenic
1094847525 12:34367872-34367894 ACTTGGGCCCCAGGCATGCGTGG + Intergenic
1098677851 12:73314134-73314156 AATAGGCCCCCAGTCTCTCCTGG + Intergenic
1102258041 12:111427578-111427600 CCTTGGGCCCCAGACCTTCCCGG + Intronic
1103593870 12:122011224-122011246 ACTTTGGGGCTAGTCTTTCCTGG - Intergenic
1108831813 13:54488395-54488417 ATTAGGGCCCCAGTCCTTTCTGG - Intergenic
1109120865 13:58455185-58455207 ACTAGGCCCCCAGTCTCTTCTGG - Intergenic
1109308931 13:60670098-60670120 AATTGACCCCCAGTCTATCCTGG + Intergenic
1112620967 13:101053142-101053164 ACTTGGGTCACAGTGTTCCCTGG - Intergenic
1113738765 13:112696835-112696857 ACTTGGGTCTCTGTCCTTCCCGG - Intronic
1113951176 13:114071784-114071806 ATATGAGCCCCAGTCTCTCCAGG + Intronic
1115450694 14:33543833-33543855 ACTTGGACCCCATTCTTTCATGG - Intronic
1116343726 14:43760718-43760740 TATTGGTCCCCAGTCTTTTCTGG + Intergenic
1118616231 14:67576240-67576262 ACCTGATCCTCAGTCTTTCCAGG + Intronic
1120121304 14:80682765-80682787 ACATAGGCCCCAATCTCTCCTGG - Intronic
1121259076 14:92553242-92553264 GCTTGGGCCCCAGCCTCCCCCGG - Intronic
1122350175 14:101084429-101084451 ACCTGAGCCCCAGTCCTTCCAGG - Intergenic
1127356399 15:58205014-58205036 ACTTGGTACCCAGTCCTTGCTGG + Intronic
1129725070 15:77897545-77897567 ACTGGGGCCCGAGGTTTTCCAGG + Intergenic
1131156149 15:90076970-90076992 ACCTGGAGCCCAGTCATTCCAGG - Intronic
1132088498 15:98927852-98927874 ACTTGATCCCCAGTGATTCCAGG + Intronic
1132911892 16:2318033-2318055 GCATGCTCCCCAGTCTTTCCTGG + Intronic
1134000668 16:10780404-10780426 AGTTGTGCCCAGGTCTTTCCTGG - Intronic
1135083680 16:19457656-19457678 ATTTGGGCCCCAGATCTTCCAGG - Intronic
1136286472 16:29247075-29247097 CTTGGGGCCCCAGTCTTTCATGG + Intergenic
1137321960 16:47393193-47393215 ACATGGTCCCCAGAGTTTCCTGG + Intronic
1139169465 16:64613876-64613898 TATTGGCCCCCAGTCTTTACTGG + Intergenic
1140074333 16:71683455-71683477 ACTTGGGTCCCAGTGCTTCTTGG - Intronic
1140732561 16:77870007-77870029 CCTTGGTCCCTATTCTTTCCAGG - Intronic
1141890734 16:86924902-86924924 CCTGTGGCCCCAGCCTTTCCTGG - Intergenic
1141963292 16:87423947-87423969 ACGTGTGCCCCAGTCGTACCAGG - Intronic
1142091827 16:88217373-88217395 CTTGGGGCCCCAGTCTTTCATGG + Intergenic
1147904912 17:43816431-43816453 ACGTGCGGCCCAGCCTTTCCAGG - Intronic
1149829274 17:59856990-59857012 TCTTGGACCACATTCTTTCCTGG + Intergenic
1150134787 17:62689781-62689803 CCCTGGGCCCCAGCCTTGCCCGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151265023 17:72948146-72948168 GTTTGGGTCCCAATCTTTCCTGG - Intronic
1151413354 17:73945851-73945873 CTTTGGGCACCAGCCTTTCCAGG + Intergenic
1152395668 17:80031335-80031357 CTTTGGGCCCCAGGCTTTCCGGG - Intronic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1153028440 18:691662-691684 ACATGGGGCTCATTCTTTCCTGG + Intronic
1157511670 18:48279732-48279754 TCTTGAGCCCCAGGCTGTCCAGG + Intronic
1157572738 18:48723705-48723727 ACCTGTGCCCCTGTCTCTCCTGG - Intronic
1158686686 18:59621138-59621160 ACTGGGGCCCCAGGGCTTCCAGG + Intronic
1159764714 18:72474345-72474367 CCTTGTGCCCCAGTGCTTCCTGG + Intergenic
1161160720 19:2760644-2760666 GACTGGGCCCCAGTCTTTCAAGG - Intronic
1161366606 19:3883544-3883566 ATTTGGGACCCAGTCATTCTTGG + Intronic
1162251506 19:9448035-9448057 AATAGGCCCCCAGTCTTTTCTGG - Intergenic
1163300100 19:16439773-16439795 ACTTGTGATCCAGTCTGTCCAGG - Intronic
1164101071 19:22054825-22054847 TCTTGGGCTTCAGTATTTCCTGG + Intronic
1164563909 19:29312416-29312438 ACTTGAGCCCAAGGCTTGCCTGG + Intergenic
1165206429 19:34192217-34192239 ACCTGTGCCACTGTCTTTCCTGG + Intronic
1165240955 19:34466923-34466945 GTTTGGGCCCCACTTTTTCCGGG - Exonic
925745192 2:7038164-7038186 ACCTGGCCCCCTGTCCTTCCTGG - Intronic
925750631 2:7088285-7088307 AATTGGCCCCCAGTCTCTTCTGG + Intergenic
927491064 2:23521248-23521270 GCTTGGGCCACAGCCTTCCCTGG - Intronic
927938653 2:27089730-27089752 AGTGGGGACCCAGTCCTTCCTGG + Intronic
930192001 2:48469128-48469150 TCATGGGGGCCAGTCTTTCCTGG - Intronic
932868116 2:75368396-75368418 AATAGGGCCCCAGTCTCTCTTGG + Intergenic
932984200 2:76706401-76706423 TATTGGCCCCCAGTCTCTCCTGG + Intergenic
933951024 2:87329903-87329925 ACGTGGGCACGATTCTTTCCTGG + Intergenic
936328751 2:111528677-111528699 ACGTGGGCACGATTCTTTCCTGG - Intergenic
941809630 2:169742702-169742724 ACTTTAGCCCCAGGCTTCCCTGG + Intronic
942663894 2:178296076-178296098 AATTGGGCCCCATTCTTCACTGG - Intronic
945452119 2:210005664-210005686 ACTGGGCCCTCAGTCTTACCAGG + Intronic
948654353 2:239467186-239467208 AGCTGGGCCGCAGGCTTTCCTGG + Intergenic
1168829668 20:838783-838805 ACTTGGCCCTCAGGCCTTCCAGG - Intronic
1169454616 20:5741268-5741290 ATTTGGACCACAGTCTTTCCAGG + Intergenic
1172057761 20:32166122-32166144 ACCTGGCCCCCAGTACTTCCAGG - Exonic
1174198673 20:48791641-48791663 CCTTGGGCACCCCTCTTTCCTGG - Intronic
1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG + Intergenic
1181387497 22:22557063-22557085 ACCTGAGCACCAGTGTTTCCTGG + Exonic
1183241224 22:36659594-36659616 TCTTTGGCCCCACTCCTTCCTGG - Intronic
1183780518 22:39995822-39995844 CCTCGGCCCCCAGTCTTCCCTGG - Intronic
1184144322 22:42599930-42599952 ACTTGGGCCCCAGTCTTTCCAGG - Intronic
1184144323 22:42599939-42599961 ACTGGGGCCCAAGTCTTCACAGG + Intronic
1184727185 22:46353998-46354020 CCTTGGTCCCCTGCCTTTCCTGG + Intronic
1185044105 22:48520403-48520425 CCTTGGGCCCCAGGCCTTCGGGG - Intronic
1185372623 22:50468069-50468091 TCCTGGGCCTCAGTCTCTCCGGG + Intronic
951196936 3:19835240-19835262 AAGTGGGCCTCAGTCTTTCTGGG + Intergenic
953419969 3:42746912-42746934 ACTTGTGCCCCAGTAGATCCTGG - Intronic
953573991 3:44098165-44098187 ATGTGGGCCACAGTCTCTCCAGG - Intergenic
954111461 3:48435837-48435859 ACTCCGCCCCCAGACTTTCCAGG + Intronic
956400845 3:68878096-68878118 AGGTGTGCCCCAGTTTTTCCAGG + Intronic
957584146 3:82113212-82113234 TATTGGCCCCCAGTCTTTTCTGG + Intergenic
958890246 3:99775201-99775223 ACCTGGGCTCCAGTCTCTCCTGG + Intronic
958928706 3:100186659-100186681 ACTTGGGCTCTTGTCTTTCCTGG - Intronic
961176201 3:124837154-124837176 ACTTGGGACCCAGAGCTTCCAGG + Intronic
961765278 3:129205645-129205667 CCTTGGGTCACAGTCTTTGCAGG + Intergenic
963600874 3:147378023-147378045 ACTTAGGCCCCCGCCTCTCCTGG - Intergenic
968085663 3:195872866-195872888 ACTGGGGCCCCGGCCTTGCCAGG - Intronic
968180911 3:196594625-196594647 ATTAGGGACCCAGTCTTTTCTGG - Intergenic
968511052 4:996142-996164 ACCTGGGCCCCAGTGGTCCCTGG + Intronic
968549291 4:1214070-1214092 ACTGGGGCCTCACTCTCTCCTGG + Intronic
969905786 4:10394648-10394670 AATTGGCCCCCAGTCTCTACTGG + Intergenic
971958609 4:33455647-33455669 ACTAGGCCCCCAATCTCTCCTGG - Intergenic
974022048 4:56700413-56700435 ACTAGGACACCAGCCTTTCCTGG + Intergenic
977732163 4:100366629-100366651 ACTTGGGCCCCATTTCTTCAAGG + Intergenic
980503804 4:133689507-133689529 TATTGGCCCCCATTCTTTCCTGG + Intergenic
983628925 4:169829362-169829384 ACATGGGCCCCAATCTCTTCTGG - Intergenic
983758021 4:171365942-171365964 ACTTGGGCCCCTAACTCTCCAGG - Intergenic
983938372 4:173518577-173518599 GCTTGGGCCGCAGGCTTCCCTGG + Intergenic
986129847 5:4919288-4919310 ACTTGGCCCCCAGTCAATCAGGG + Intergenic
986400903 5:7378665-7378687 GATAGGGCCCCATTCTTTCCAGG - Intergenic
988926009 5:35991563-35991585 ACTGAGGCCCCTGTCATTCCTGG - Exonic
988993590 5:36693725-36693747 ACTTGAGCCCCAGGACTTCCAGG - Intergenic
991571724 5:68061487-68061509 TCTTGGCCCCCAGTCTCTTCTGG - Intergenic
992042865 5:72853672-72853694 ACTTGTGTCCCAATCTTCCCAGG - Intronic
992748286 5:79839799-79839821 ACTTGGGCCACCATGTTTCCAGG + Intergenic
993309833 5:86314716-86314738 TCATGGGGACCAGTCTTTCCGGG + Intergenic
995869324 5:116727764-116727786 GCCTGGGCCTGAGTCTTTCCGGG + Intergenic
996663353 5:126029117-126029139 TCTTGGCCCCCAGTCTCTTCTGG - Intergenic
996894026 5:128457624-128457646 TATTGGACCCCAGTCTTTTCTGG - Intronic
997843847 5:137267822-137267844 ACTTTGACCCCATTGTTTCCTGG + Intronic
1000746103 5:165035996-165036018 ATTTAGGCCCCAGTCTCTTCAGG + Intergenic
1001140833 5:169142552-169142574 ACTTGGAACCTAGTCATTCCAGG - Intronic
1001583962 5:172820361-172820383 ACTTGGGCCCCAGACTCCCCAGG + Intergenic
1001679777 5:173547564-173547586 AGTTGGGCCCCAGCCTCTCCAGG - Intergenic
1001957359 5:175857157-175857179 ACCTGGGCTCCATTCTGTCCTGG + Intronic
1002303994 5:178272842-178272864 ACATGGCCGCCAGTCCTTCCTGG + Intronic
1002696725 5:181097395-181097417 CCTTGGGCCCCACGCTTTCCCGG - Intergenic
1002697897 5:181101978-181102000 CCTTGGGCCCCACGCTTTCCCGG + Intergenic
1007438114 6:41832170-41832192 ACTTGACCCCAAATCTTTCCTGG + Intronic
1007585875 6:42989149-42989171 AATTGCCTCCCAGTCTTTCCAGG + Intronic
1007744006 6:44031103-44031125 TCTTGAGCCCCAGTCTTTTGAGG - Intergenic
1008719338 6:54329295-54329317 TATTGGCCCCCACTCTTTCCTGG - Intronic
1010988938 6:82458052-82458074 AATAGGTCCCCAGTCTCTCCTGG + Intergenic
1011310985 6:85979329-85979351 AATAGGCCCCCAATCTTTCCTGG - Intergenic
1011394440 6:86891523-86891545 AGCTGGGCACCAGTCTTTGCAGG + Intergenic
1012538150 6:100324860-100324882 AATAGGCCCCCAGTCTCTCCAGG + Intergenic
1015139970 6:129919781-129919803 ACTTAAGCCCCAGTATTTCAAGG + Intergenic
1015902087 6:138077806-138077828 TATTGGCCCCCAGTCTTTTCTGG - Intergenic
1016847771 6:148586220-148586242 TATTGGCCCCCAGTCTTTTCTGG + Intergenic
1017905914 6:158757469-158757491 TCTTGGGTCCAAGTCTTGCCAGG - Intronic
1017935288 6:158999849-158999871 CCTTGTGCCGCAGTCCTTCCCGG - Exonic
1019622030 7:1997390-1997412 ACCTAGGCCCCAGCCTTTCCAGG + Intronic
1021103735 7:16613695-16613717 ACTTGGAACCCAGTCTTTCAGGG - Intronic
1021304496 7:19015119-19015141 AAATAGGCCCCAGTCTCTCCTGG + Intergenic
1022349080 7:29549833-29549855 ACTTGGAAGCCAGTCTTTCTGGG + Intergenic
1023084986 7:36561466-36561488 ACAAGGGCTCCAGTCTTTCTGGG + Intronic
1026349407 7:69502790-69502812 TCTTGGGCCACTGTCTTCCCAGG + Intergenic
1027250191 7:76393875-76393897 AGTTGGCCCCCAGCCTTCCCGGG - Exonic
1028868580 7:95740141-95740163 AATGGGCCCCCAGTCTCTCCTGG - Intergenic
1031591090 7:123593597-123593619 ACTTGGCCCCCACTCTCTTCTGG + Intronic
1035220342 7:157402668-157402690 ACGTAGGCCCCAGTCATCCCAGG + Intronic
1035921287 8:3678858-3678880 TATTGGCCCCCAGTCTTTTCTGG - Intronic
1042393603 8:68264874-68264896 ACTTTGTCACCAATCTTTCCAGG + Intergenic
1044308368 8:90664469-90664491 AATAGGTCCCCAGTCTCTCCTGG + Intronic
1047700366 8:127443371-127443393 ATTTGGGCTTCAGTCTTTCTGGG + Intergenic
1049410847 8:142473387-142473409 ACCTGGGCCCCAGACAGTCCTGG + Intronic
1051116057 9:13696192-13696214 TATTGGCCCCCAGTCTTTTCTGG + Intergenic
1051830964 9:21276015-21276037 TATTGGGCCCCACTCTTTACTGG + Intergenic
1053433334 9:38058427-38058449 AATTGGGCCTCAGGATTTCCTGG - Intronic
1053440495 9:38112257-38112279 TGTTGGGCACCAGTCTCTCCTGG + Intergenic
1054828185 9:69594374-69594396 TCTTGGGCCCCAGTCTCCTCTGG + Intronic
1055345225 9:75328313-75328335 AAATAGGCCCCAGTCTTTTCTGG - Intergenic
1057180310 9:93026275-93026297 AGCTGGGCCCAAGTCTCTCCAGG - Intronic
1062119785 9:134828058-134828080 ACGTGAGCCCCAGTCAGTCCAGG + Intronic
1062330890 9:136044520-136044542 TCTTGGGCCCCACCCTATCCAGG + Intronic
1062583312 9:137237710-137237732 CCTTGGCCCCCAGTCTTCCCTGG + Intergenic
1186913195 X:14192084-14192106 TATTGGCCCCCAATCTTTCCTGG + Intergenic
1189760768 X:44319424-44319446 ACCCGGGCCTCACTCTTTCCAGG + Intronic
1190444346 X:50508275-50508297 AGTGGGGCCACAGTTTTTCCTGG - Intergenic
1190917977 X:54824351-54824373 ACCTGGGGCCCAGTCTTTGGAGG - Intergenic
1190966538 X:55306324-55306346 AATAAGGCCCCAGTCTCTCCTGG + Intergenic
1191067907 X:56369782-56369804 TATTGGCCCCCAGTCTTTTCTGG - Intergenic
1191668467 X:63727042-63727064 ACTTGGGACCCATCTTTTCCAGG - Intronic
1192111126 X:68366106-68366128 ACTGGGGCCCCAGTCTCTCTGGG + Intronic
1192151661 X:68716586-68716608 TCTAGGACCCCATTCTTTCCTGG + Intronic
1192293028 X:69817036-69817058 ACATTGGCCCCAATCTTTTCTGG - Intronic
1194175018 X:90634581-90634603 ACTAGGCCCCCAATCTTTTCTGG - Intergenic
1195147361 X:102030850-102030872 TATTGGTCCCCAGTCTTTTCTGG - Intergenic
1195353134 X:104013361-104013383 ACCAGGGCCTCAGCCTTTCCCGG - Exonic
1196895736 X:120333888-120333910 TCTTGGGTCCCATTCTTTTCAGG - Intergenic
1197634141 X:128895711-128895733 GCTTGGGACCCAGACTTGCCTGG + Intergenic
1198065160 X:133088966-133088988 ACTCTGGCCCCAGTTTTTACTGG + Intronic
1201920744 Y:19231139-19231161 TATTGGCCCCCACTCTTTCCTGG + Intergenic
1202171338 Y:22047894-22047916 ACTTGGGCCCCATTTTTTCTTGG - Intergenic
1202220024 Y:22538478-22538500 ACTTGGGCCCCATTTTTTCTTGG + Intergenic
1202323092 Y:23657188-23657210 ACTTGGGCCCCATTTTTTCTTGG - Intergenic
1202547680 Y:26012866-26012888 ACTTGGGCCCCATTTTTTCTTGG + Intergenic