ID: 1184147015

View in Genome Browser
Species Human (GRCh38)
Location 22:42617706-42617728
Sequence CAGTGTGGCTGGAGGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 965
Summary {0: 1, 1: 3, 2: 38, 3: 146, 4: 777}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184147015_1184147027 16 Left 1184147015 22:42617706-42617728 CCCACTCCCCTCCAGCCACACTG 0: 1
1: 3
2: 38
3: 146
4: 777
Right 1184147027 22:42617745-42617767 AGGGCCACCCAGCAAGTCTCCGG 0: 1
1: 0
2: 1
3: 23
4: 253
1184147015_1184147024 -3 Left 1184147015 22:42617706-42617728 CCCACTCCCCTCCAGCCACACTG 0: 1
1: 3
2: 38
3: 146
4: 777
Right 1184147024 22:42617726-42617748 CTGGCCTCACTGTGCTCCTAGGG 0: 1
1: 0
2: 0
3: 15
4: 280
1184147015_1184147023 -4 Left 1184147015 22:42617706-42617728 CCCACTCCCCTCCAGCCACACTG 0: 1
1: 3
2: 38
3: 146
4: 777
Right 1184147023 22:42617725-42617747 ACTGGCCTCACTGTGCTCCTAGG 0: 1
1: 0
2: 4
3: 35
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184147015 Original CRISPR CAGTGTGGCTGGAGGGGAGT GGG (reversed) Intergenic
900329386 1:2126506-2126528 CAATCAGGCTGGAGGGGGGTGGG - Intronic
900596725 1:3483359-3483381 CTGTGTGGATGCAGGGCAGTGGG + Intergenic
900615972 1:3565812-3565834 GAGCGTGGCTGGAGCAGAGTTGG - Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
900804370 1:4757529-4757551 GAGTGTGGCTGGAGGGGGTGAGG + Intronic
901013067 1:6211831-6211853 CAGTGTGGATGCAGGGGGGTGGG - Intronic
901460800 1:9390389-9390411 CACTCAGGCTGGAGGGCAGTGGG - Intergenic
901494849 1:9615034-9615056 CAGTGTCCCTGGAGGGGCTTAGG + Intergenic
901800493 1:11705364-11705386 CAGTGTGGAGGGAGGGCACTGGG + Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901904517 1:12396225-12396247 CAGTGTGACTGTAGGGCCGTTGG + Intronic
901926082 1:12567112-12567134 CAGGGTGGCAGGAGGGGAGCAGG - Intergenic
902079673 1:13812526-13812548 CAGTGTGGCTGGAGCCTGGTAGG + Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
902706190 1:18206650-18206672 CAATGTAGCTGGAGCAGAGTGGG + Intronic
902890607 1:19440603-19440625 CAGTGTGGGGGGAAGGGACTTGG + Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903293504 1:22329303-22329325 CTGAGTGGCTGGAGTAGAGTGGG - Intergenic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904006316 1:27365090-27365112 TAGTGTTGCAGGAGAGGAGTTGG + Intronic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904552237 1:31328666-31328688 GGGTATGGCTGGAGTGGAGTGGG + Intronic
904824936 1:33268267-33268289 CAGAGTGGGTGGAGGGGACTTGG + Intronic
905030746 1:34882861-34882883 CCATGTGGCTGGTGTGGAGTGGG - Intronic
905093047 1:35445100-35445122 CAGTGTGGCTGGGTGGGACCTGG + Intronic
905127254 1:35724358-35724380 CAGTGTGGCTGGAGCTCGGTGGG + Intronic
905199043 1:36304122-36304144 CTGTGCGGCTGGTGGGGGGTGGG - Exonic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905771741 1:40642569-40642591 AAGGGTGGCTGGAAGGGAATAGG - Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906191423 1:43901794-43901816 CAGGGTGGGTGGGGGTGAGTGGG + Intronic
906260121 1:44380621-44380643 CAGAGAGCCTGGAGGGCAGTGGG - Intergenic
906606256 1:47174460-47174482 CAGTGTGTGTGGAGGGGCGTGGG - Intergenic
907281548 1:53350293-53350315 CAGTGTGGCTGGAGCATGGTGGG - Intergenic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907526929 1:55059194-55059216 CAGAGTGGGTGGAGTGGAGCTGG + Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908121687 1:60991808-60991830 TGGTGTGGCTGGAGGAGACTGGG - Intronic
908822664 1:68104013-68104035 CAGTGTGGCTTGCTGGGTGTGGG - Intronic
909059180 1:70860041-70860063 TAGAGTGGGTGGGGGGGAGTGGG + Intronic
909203673 1:72725712-72725734 CAATGTGGCTTTAGGGGAGATGG - Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
910092479 1:83481372-83481394 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
912480802 1:109980983-109981005 AAGTGTGGCTAGAGGGGTGGAGG - Intergenic
912679727 1:111721405-111721427 CATGGTGGGTGGAGGCGAGTTGG + Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
914824592 1:151132203-151132225 CAGCTTGGCTGGAAGGGAGCGGG + Exonic
914983675 1:152438727-152438749 GAGGGTGGATAGAGGGGAGTTGG + Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915176699 1:154021451-154021473 CATTCAGGCTGGAGGGCAGTGGG - Intronic
915363428 1:155300066-155300088 CTGTGTGGCTGCAGGGGGATGGG + Intronic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915951514 1:160192635-160192657 CTGTGTGGCTGTAGGGAATTTGG + Intronic
916073076 1:161183067-161183089 CAGTGTAGGCTGAGGGGAGTTGG - Intergenic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
917701614 1:177587384-177587406 CTGTGTGGCTGGAAGGGAATTGG - Intergenic
918042883 1:180923894-180923916 CAGTGGGGCAGGATGGGAGCTGG - Intronic
918068739 1:181119577-181119599 CAGGGTGGCTGCAGGGGATCTGG + Intergenic
918136924 1:181681945-181681967 AAGTGTGGCTGAAGAGAAGTAGG - Intronic
918649632 1:186945252-186945274 CCGTGTGGCTGAAGTGAAGTGGG + Intronic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920242849 1:204566204-204566226 CTTGGTGGCTGGTGGGGAGTTGG - Intergenic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
921056688 1:211547976-211547998 CAGTGTGGCTGAAACAGAGTGGG - Intergenic
921291501 1:213662114-213662136 AAGTGTGTCTCGAGGGGAGTGGG - Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
922350304 1:224729758-224729780 CTGTGTGGCTGGATTGGAGGTGG + Intronic
922811331 1:228416946-228416968 GAGTGTGGAGGGTGGGGAGTTGG + Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923229497 1:231971550-231971572 CAGGGTGGCTGGAGAGGAAGGGG - Intronic
923326262 1:232882900-232882922 CAGAGTGGATGGTGTGGAGTGGG - Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923546514 1:234927479-234927501 CAGGCTGGGTGGAGGGCAGTGGG - Intergenic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
923676998 1:236088703-236088725 GGCCGTGGCTGGAGGGGAGTGGG + Intergenic
923958639 1:239051776-239051798 CAGTGTGGTTGGGGCAGAGTTGG + Intergenic
1063487162 10:6430686-6430708 GAGTGGGGCTGGTGGGGAGTTGG + Intronic
1064250695 10:13704419-13704441 GGGTCTGGCTGGAGGGAAGTGGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065003522 10:21358836-21358858 CACTCAGGCTGGAGGGCAGTGGG + Intergenic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065826327 10:29574962-29574984 CAGTGTCCCTGGTGGGGTGTGGG + Intronic
1065951047 10:30651656-30651678 CAGTGTCCCTGGTGGGGTGTGGG - Intergenic
1066981682 10:42422463-42422485 CAGTGTAGCTGAAGGAGAGATGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1067850549 10:49751302-49751324 GAGTGTGGCAGGAGGGTAGTGGG - Intronic
1068513683 10:57998912-57998934 CAGTTAGGATGGAGGGCAGTGGG - Intergenic
1068880872 10:62047645-62047667 CAGGGTGGCTGGAAGGAGGTGGG + Intronic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1069727052 10:70586779-70586801 CAGTGTGTGTGGTGGGGGGTTGG + Intergenic
1069752743 10:70754612-70754634 CAGTGGGGCTGGAGCTGACTGGG + Intronic
1069859404 10:71461139-71461161 CTGTGTGGCTGCAGGGGTGGAGG - Intronic
1070662925 10:78320377-78320399 AAATGTGGCTGGAAGGGAGGTGG + Intergenic
1070675821 10:78410565-78410587 CAGTGTCTCAGGAGGAGAGTGGG + Intergenic
1070731260 10:78830135-78830157 GGGAATGGCTGGAGGGGAGTGGG - Intergenic
1070939263 10:80328915-80328937 TACTGTGGCTGGAGGGAAGGAGG - Intergenic
1070941415 10:80351488-80351510 CAGTGTGGATGGAGTGGTGGGGG - Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1072390200 10:94976604-94976626 TAGTGTGGGGGGAGGGGAGGTGG - Intronic
1072625368 10:97107849-97107871 GAGTGTGGTTGGTGGGCAGTGGG - Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1073137131 10:101226296-101226318 GAGGGTGGCTGGATGTGAGTGGG - Exonic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075504295 10:123008800-123008822 CAGGGGGGCGGGAAGGGAGTCGG - Exonic
1075518026 10:123125016-123125038 GAGTGAGGCTGGATGGGAGCAGG - Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076335859 10:129706083-129706105 CAGTGTGACTGGTGGGGGCTGGG - Intronic
1076752062 10:132548232-132548254 CAATGCAGCTGGAAGGGAGTTGG + Intronic
1077116978 11:889632-889654 CGGTGTGGCTGGCAGGGACTAGG - Intronic
1077395708 11:2320090-2320112 CAGTGCTAGTGGAGGGGAGTGGG + Intergenic
1077498471 11:2898078-2898100 GACTGTGGCTGGAGGGGAAGTGG - Intronic
1077504217 11:2922674-2922696 CTGTGTGGGTTGAGTGGAGTGGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077783207 11:5354633-5354655 CAGTGTGGCTGGTGGCGTGGAGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077908789 11:6557033-6557055 TAGTGTGGGTGGAGGGGTGAAGG - Exonic
1078211039 11:9269661-9269683 CAGGGTGGCTGGAGAGGGTTAGG + Intergenic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078860117 11:15239091-15239113 GGCTGTGGCTGGAGTGGAGTGGG + Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1079158323 11:17969520-17969542 GAGTGTGGGTGGAGGGGTGAGGG + Intronic
1079591477 11:22188488-22188510 CACCATGGCTGGAGGGTAGTTGG + Intergenic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1081600364 11:44488509-44488531 CAGTGTGGCTGGCAGTCAGTGGG - Intergenic
1082204380 11:49414668-49414690 CAGTGTGGCTTGTGGGTAGGAGG - Intergenic
1082210785 11:49498653-49498675 ATGTGTGGCTGGAGGTGAGCTGG - Intergenic
1082269781 11:50157397-50157419 TGGTGTGGCTGGAGGGGGGAGGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083001379 11:59294618-59294640 CAGGCTGGCTGGAGTGTAGTGGG + Intergenic
1083486018 11:62983496-62983518 CTGGGTGGCCGGAGGGGAGTGGG + Intronic
1083591575 11:63898420-63898442 CAGTGTGCCAGAAGGGGAGATGG - Intronic
1083638042 11:64130748-64130770 CAGGGTGGCGGGTGGGGAGGTGG - Intronic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1084006556 11:66326403-66326425 CAGTGGGGGTGGAGGGGTGGAGG + Intergenic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084434820 11:69132552-69132574 CAGGGAGGCTGGAATGGAGTTGG - Intergenic
1084674691 11:70627288-70627310 CAGTGTGGTGGGTGGTGAGTTGG - Intronic
1084684863 11:70687584-70687606 CAGTGTGGGGGTAGGGGGGTGGG + Intronic
1084730699 11:71071720-71071742 CAGAGTGGCTGGAGGGGCCTGGG + Intronic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085278298 11:75314060-75314082 CAGTGTGGCTGGAGGGTGTGTGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085882255 11:80481353-80481375 TAGGGTGACTGGAGGGGAGCTGG + Intergenic
1086049910 11:82577564-82577586 AAGCGGGGCTGGAGGGGAGGGGG + Intergenic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086638854 11:89126136-89126158 ATGTGTGGCTGGAGGTGAGCTGG + Intergenic
1087620666 11:100538053-100538075 CAATATGGCTGCAGGGCAGTGGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1088116035 11:106315916-106315938 CAGAGAGGAAGGAGGGGAGTTGG - Intergenic
1088977689 11:114830351-114830373 CACTTTGTCTGGAGGGGAGGAGG + Intergenic
1089352556 11:117829676-117829698 CGGTGTGGGTGGGGGGGATTTGG - Intronic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089744202 11:120605718-120605740 CAGCGTGGCTGAAGGGCAGGGGG - Intronic
1089778769 11:120858177-120858199 CAGTGTGGCTGGGGCGGGGTTGG + Intronic
1090361090 11:126173195-126173217 CCGTGTGGCTTGAGGGGAAAGGG + Intergenic
1090421455 11:126578266-126578288 CAGAGAAGCTGGAGGGGAGAGGG - Intronic
1090877835 11:130806797-130806819 CAGGGTGGGAGGAGGGGAATGGG - Intergenic
1091446390 12:546216-546238 GGGTGTGGGAGGAGGGGAGTGGG + Intronic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1091744360 12:2981774-2981796 CAGGGGTGCTGGAGGGTAGTGGG + Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1092650781 12:10632439-10632461 CAGTGTAGCTGGAGCCAAGTGGG + Intronic
1092919963 12:13222379-13222401 GGGTGTGGCTGGAGGAGGGTTGG + Intergenic
1092959677 12:13584145-13584167 CAGTGTGGCTCCTGAGGAGTGGG - Intronic
1094047108 12:26179263-26179285 TAGTGTGGCTGGACAGGAGAAGG + Intronic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094436841 12:30430269-30430291 CAGTGTGGCTGGTGCCCAGTGGG - Intergenic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1094554288 12:31482996-31483018 CATTGTTGCTGGAGCAGAGTGGG - Intronic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1094839668 12:34337665-34337687 ATGTGTGGCTGGAGGGACGTGGG - Intergenic
1094843343 12:34351032-34351054 ATGTGTGGCAGGAGGGGCGTTGG + Intergenic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1096648823 12:53052222-53052244 CAGGGTGGGTGGAGGTGAGGAGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096878394 12:54647993-54648015 CAGAGTGGTTGGAGCAGAGTGGG + Intronic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097285622 12:57874942-57874964 CAGTGTGGCTGGAGCAATGTAGG + Intergenic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1099693789 12:85993530-85993552 CAGTGGGGCTGGAGGGGCCTTGG + Intronic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1100815034 12:98378678-98378700 CAGTGTGGGTGAAGTGAAGTGGG - Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1101440902 12:104703705-104703727 CAGTGAGCCTGGAATGGAGTGGG - Intronic
1101646881 12:106639365-106639387 CAGAGTAGCAGGAGTGGAGTGGG - Exonic
1102159800 12:110759376-110759398 GAGTGTGGCTGGCTGGGAATAGG + Intergenic
1102189195 12:110973289-110973311 GAGGGTGGCGGGTGGGGAGTGGG + Intergenic
1102233730 12:111281223-111281245 CCCAGTGGCTGGAGTGGAGTTGG - Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102807601 12:115795580-115795602 CAGCCTGGCTGGAGGTGAATGGG - Intergenic
1102914058 12:116739698-116739720 CACTGTGGGTGGACAGGAGTGGG + Intronic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1103961062 12:124609632-124609654 CAGTGTGGCTGGACCTGGGTCGG - Intergenic
1104061997 12:125276554-125276576 CTGAATGGCTGGAGTGGAGTTGG + Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104971504 12:132532841-132532863 CAGGGAGGCTGGAGGTGGGTGGG + Intronic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106346659 13:28886099-28886121 CAGAGTTGCTGGTGGGGAGAGGG + Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106602128 13:31197177-31197199 TAGTGTGGCGGGTGGGGAGAGGG - Intergenic
1107349976 13:39503451-39503473 CAAAGTGGCAGGAGGGGATTGGG - Intronic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1107606025 13:42057936-42057958 CAGTGGGGCTGAAGGGGGTTGGG + Intronic
1108482838 13:50892287-50892309 CTATGTGGCTGGAGGGGTGGGGG - Intergenic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1109123595 13:58489015-58489037 CAGTGTGGCTGAGGCTGAGTGGG + Intergenic
1110187200 13:72689154-72689176 CAGTGTGGAAGAAGGGGTGTGGG - Intergenic
1110326252 13:74219000-74219022 CACTCAGGCTGGAGGGCAGTGGG + Intergenic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1110557555 13:76877617-76877639 CAATGGGGGTGGTGGGGAGTGGG - Intergenic
1110904400 13:80867358-80867380 AAGGCTGGCTTGAGGGGAGTAGG - Intergenic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1112494240 13:99893225-99893247 CAGTGTGGCTAGAGGCCATTCGG - Exonic
1113056707 13:106275835-106275857 CAGTCAGGGTGGAGCGGAGTTGG + Intergenic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114669153 14:24399562-24399584 CAGTGTGGCAGGCAGGTAGTGGG + Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115731180 14:36271503-36271525 CACTGGGGCTTGAGGGGAGGGGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1117160992 14:52989500-52989522 AAGGGTTGTTGGAGGGGAGTGGG - Intergenic
1118026253 14:61772135-61772157 CACCGTGGCTGGAGCGCAGTAGG + Intronic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119216973 14:72876543-72876565 CTGTTTGGCTGGTTGGGAGTAGG - Intronic
1119615951 14:76099323-76099345 GAGTGAGGCCGGAGCGGAGTCGG - Intergenic
1119664015 14:76471514-76471536 CAGGGAGGCTGGAGCAGAGTGGG - Intronic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121230672 14:92355277-92355299 GAGTGTGGCTGGAGCGGGGTGGG + Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121333044 14:93059931-93059953 CAGTGTGGATGGGGGTGAGCAGG - Intronic
1121498221 14:94412505-94412527 CAGTATAGCTGGAGTGGAATGGG - Intergenic
1121525153 14:94614356-94614378 CAGGCTGGGTGGAGGGCAGTGGG + Exonic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122985016 14:105208055-105208077 CACAATGGCTGGAGGGGAGGTGG - Intergenic
1123016346 14:105377368-105377390 CTCTGTGGCTGGATGGGAGGAGG + Intronic
1123097615 14:105773869-105773891 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1123097632 14:105773948-105773970 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1123805247 15:23864580-23864602 AAGTGTGTGTGGAGGGTAGTGGG - Intergenic
1124045068 15:26141150-26141172 AAGTGTGGCTGGAGCTGATTTGG + Intergenic
1124342672 15:28900241-28900263 CAGTGTGGCTGTGTGGGAATGGG + Intronic
1124700579 15:31908656-31908678 CAGAGAAGCTGGTGGGGAGTGGG + Intergenic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1124991323 15:34676890-34676912 CAGTGTGGTGGGAGAGCAGTGGG + Intergenic
1125887246 15:43238139-43238161 CAGGGTGGCTGAAGGGCGGTGGG - Intronic
1125919806 15:43518639-43518661 CAGTGAGGCAGAAGGGGAGGGGG - Intronic
1126415824 15:48416502-48416524 AAGTGTGGCTGGAAGAGATTTGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1126789130 15:52204669-52204691 GGGTGTGGCGTGAGGGGAGTAGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127606107 15:60590855-60590877 CCCTGTGGCTTGAGGGGAATGGG - Intronic
1128285641 15:66434851-66434873 CCGGGTGGCTGGAGTGAAGTGGG + Intronic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128510756 15:68312752-68312774 GGGTGAGGCTGGAGGGGAGCCGG - Exonic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1128988352 15:72237574-72237596 CATTCTGGCTGGTGGGGAGAGGG - Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129296772 15:74604167-74604189 CTGTGGGGCTGGAGGTGTGTGGG + Intronic
1129503687 15:76063410-76063432 CAGTGTGGATGGAGCAGAATAGG - Intronic
1129712341 15:77826695-77826717 CAGGCTGGCTGGAGGTGGGTGGG + Intergenic
1130306195 15:82713587-82713609 GAGTGAGGGTAGAGGGGAGTAGG - Intergenic
1130747350 15:86669832-86669854 AAGTGTGTGTGGAGGGGAGTGGG + Intronic
1130854276 15:87827111-87827133 CAGTGGGGTTGGATGGGAATTGG + Intergenic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130987168 15:88852091-88852113 CAGTGTGCCTGGTGGGGCGGGGG + Intronic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131527242 15:93162269-93162291 GAGTGTGTCTGGTGGGGAGGGGG - Intergenic
1131873905 15:96784789-96784811 CAGAGTGGCTGGATGGGCCTTGG + Intronic
1132265913 15:100470515-100470537 CAGAGTGACTGTAGTGGAGTGGG + Intronic
1132649652 16:1014677-1014699 CAGCCAGGCTGGAGGTGAGTGGG + Intergenic
1132723103 16:1326499-1326521 CAGAGTCGCTGGAGGGGTGGTGG - Exonic
1133235939 16:4387466-4387488 CCATGTGGCTGGTGTGGAGTAGG + Intronic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134066024 16:11228887-11228909 CAGTGTGCCTGGCGCGGAGCAGG - Intergenic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134690347 16:16187092-16187114 GAGTCTGGCAGGAGGGGTGTGGG - Intronic
1135470738 16:22728139-22728161 CAATGTGGCTGGCAAGGAGTGGG + Intergenic
1135668969 16:24359056-24359078 CACGGTGGGTGGCGGGGAGTGGG - Intronic
1135961924 16:27002132-27002154 CAGTGTGGCTGGAAGAGAATAGG + Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1136054789 16:27680319-27680341 CAGCATGGCTGCAGGGGAGACGG + Intronic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137758918 16:50924966-50924988 CAGCCTGGCAGGTGGGGAGTGGG - Intergenic
1137768632 16:50996812-50996834 CAGTGGGGCTGGGGGAGGGTGGG - Intergenic
1137860485 16:51841735-51841757 CAAGGTGGCTGGTGGGGTGTCGG + Intergenic
1138133713 16:54503316-54503338 AAGTGTCCCTGGATGGGAGTAGG - Intergenic
1138197210 16:55060501-55060523 CCATGTGGCTGGAGCAGAGTGGG - Intergenic
1138304564 16:55962622-55962644 GGGTGTGGCTGGAGAGGAGCAGG - Intergenic
1138476213 16:57271974-57271996 CTGTGTGGTTGGAGGGGCCTGGG - Intronic
1138537671 16:57668420-57668442 CAGCGTGGCAGGAGGGGATGAGG - Intronic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1138731940 16:59205180-59205202 TAGTGTGGAGGTAGGGGAGTTGG + Intergenic
1139560686 16:67739856-67739878 AAGTGAGGGTAGAGGGGAGTGGG + Intronic
1140455945 16:75105607-75105629 CAGTGTGGCTGGTGCAGAGGAGG + Intronic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142679179 17:1535535-1535557 AATTGGGGTTGGAGGGGAGTGGG + Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1142958115 17:3535048-3535070 CAGAGGGGCAGGAGGGGAGGAGG - Intronic
1143092228 17:4455674-4455696 CAGTGTCGTGGGAGGGGAGAGGG - Intronic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1143686172 17:8517823-8517845 CAGTGTGGCTGGAGCAGGATGGG - Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1144330842 17:14222802-14222824 CACTGTGGCTGGAGCAGTGTGGG - Intergenic
1144422632 17:15112011-15112033 CACTGTAGCAGGAGGGGAGTGGG + Intergenic
1144461341 17:15460894-15460916 CACTGTGGCTGGAGGGTGGTTGG - Intronic
1144465827 17:15496442-15496464 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1144537487 17:16105012-16105034 CAGTGTGGTTGGAGCAGAGGGGG + Intronic
1144620714 17:16816765-16816787 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144827725 17:18115772-18115794 CCAGGTGGCTGGAGGGCAGTGGG - Intronic
1144831113 17:18131686-18131708 CACCGTGGCTGGAGGAGGGTCGG - Intronic
1144944701 17:18963942-18963964 CAGTGTGGCTGGAGCGGGTGGGG - Intronic
1145147293 17:20492995-20493017 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1145280507 17:21464000-21464022 CAGTCTGGCAGGCGGGGAGGCGG - Intergenic
1145414506 17:22703789-22703811 CAGTGCGGCTGGGGTTGAGTTGG + Intergenic
1145737238 17:27241473-27241495 CAGAGTGGAGGGTGGGGAGTGGG + Intergenic
1145978797 17:28999421-28999443 CAGTCTGGCAGGAAGGGAGGGGG - Intronic
1145987603 17:29057639-29057661 CAGGGTGGGTGGAGGGGTGAGGG + Intergenic
1146010072 17:29187087-29187109 CAGTGTGGGGGTTGGGGAGTAGG - Intergenic
1146017684 17:29246996-29247018 TAGGGTGGCTGGAGAAGAGTGGG + Intronic
1146056283 17:29582900-29582922 GAGTGGGGCTGGAGGGGTGGTGG - Intronic
1146696370 17:34911679-34911701 CAGTGTGGCTGGAGAGAGTTGGG + Intergenic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147572104 17:41577663-41577685 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1147647350 17:42041690-42041712 CAGGGTGACTGGTTGGGAGTTGG - Intronic
1148105069 17:45114626-45114648 CAGTGGAGCTGGAGGGCCGTGGG - Intronic
1148689688 17:49520138-49520160 CAGTGTGGGGGCAGGGGTGTTGG - Intergenic
1148871672 17:50662118-50662140 CAGGGTGGCTGGATGGAAGTGGG + Intronic
1149217774 17:54377843-54377865 CAGTGTGGCTGTTGCTGAGTGGG - Intergenic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1150292217 17:63988469-63988491 CAGAGTGGCCTGAGTGGAGTTGG - Intergenic
1150365597 17:64581336-64581358 GAGTGTGGCTGAAGCAGAGTGGG - Intronic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1151480953 17:74369813-74369835 CAGTGTGGCTTCAGGGGAACAGG + Intronic
1151487554 17:74410744-74410766 CAGGGTGGCTGGGGTAGAGTGGG + Intergenic
1151618758 17:75232067-75232089 CAGTGTGGCTCGTGAGGAGGAGG - Intronic
1151853397 17:76705012-76705034 CAGTGTGGTTTGAGCCGAGTGGG + Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152229827 17:79108867-79108889 CAGTGGGGCAGGCTGGGAGTGGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152525945 17:80888484-80888506 CTGTGTTGTTGGAGCGGAGTGGG + Intronic
1152778387 17:82215770-82215792 CAGTGCGGGTGGCCGGGAGTTGG + Intergenic
1153094358 18:1383661-1383683 CAATGCAGCTGGAGGGGAGCAGG - Intergenic
1153238025 18:3006957-3006979 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1153280708 18:3411738-3411760 CAGCGTGGCTGGGGCGGAGTAGG - Intronic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1154245391 18:12692439-12692461 CTGTGTGGCTAGAGCGTAGTGGG - Intronic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155267037 18:24104325-24104347 CAGTGGGGCAGGGGTGGAGTGGG - Intronic
1155775993 18:29762356-29762378 CAATGTGGCTGGAGTGAACTGGG - Intergenic
1155996060 18:32332635-32332657 CAGGGAGGCTGAAGGAGAGTGGG - Intronic
1156276890 18:35592486-35592508 CAGTGTGGCTGAAGGGCCATTGG + Intronic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1157242631 18:46025390-46025412 CAGTGGAGCTGGAAGAGAGTGGG - Intronic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1158253439 18:55516782-55516804 GAGTGTGGCTGGTGTAGAGTGGG + Intronic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1159293801 18:66454938-66454960 CCCTGTGGCTGGAGGAGATTAGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1161125055 19:2551115-2551137 CAGCGTGGCTGGACGGCAGGTGG - Intronic
1161204605 19:3034461-3034483 CAGGGTGGCTGGAGGGGGTTGGG - Intronic
1161407354 19:4097991-4098013 CAGTCTGGCTGGAGAGGAGGAGG + Intronic
1161627090 19:5333608-5333630 CTTTGTGGCTGGAGGTGAGGGGG - Intronic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1161649419 19:5475118-5475140 CAGTGTGGCTGGAGTGAGCTGGG + Intergenic
1161906105 19:7157724-7157746 CAGAGTGGCAGCAGGGGAGGTGG - Intronic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163005888 19:14396494-14396516 CCGTGAGGCTGGACGGGAGCTGG + Intronic
1163061857 19:14766935-14766957 CTGTGAGGCTGGACGGGAGCTGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1164759124 19:30715063-30715085 CAGAGTGGCGAGAGGAGAGTTGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165072689 19:33264685-33264707 CAGTCTGGCAGGAGGTGAGCAGG - Intergenic
1165353619 19:35290928-35290950 TTGTGGGGCTGGGGGGGAGTTGG - Intergenic
1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG + Intergenic
1165422894 19:35731270-35731292 CAGTGTGGCTGTAAGGGGGCCGG - Intronic
1165466589 19:35978520-35978542 AAGTGAGGGAGGAGGGGAGTGGG - Intergenic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1165921906 19:39304296-39304318 CAGTGTGTCTGGACTGAAGTGGG - Intergenic
1165995338 19:39839941-39839963 CAGGGTGGCTGGAGGACACTTGG + Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1166133991 19:40764225-40764247 CAGTGTTTGTGGTGGGGAGTTGG + Intronic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166199002 19:41224196-41224218 AAGTGTGCCTGGAGGGTAGTGGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166552079 19:43672505-43672527 CAGTGTGGCTGGAACAGATTAGG + Intergenic
1166729375 19:45050121-45050143 CTGTGTGCCTGGAGCAGAGTAGG + Intronic
1166924824 19:46260387-46260409 CATTGTGGGTGCAGGGGAGCGGG - Intergenic
1166960040 19:46491802-46491824 CAGTGGGGCAGGCGGGGTGTGGG - Exonic
1167708578 19:51096859-51096881 CAGTGTGGCGGGAACAGAGTGGG - Intergenic
1167792323 19:51689938-51689960 ACGTCTGGCTGGAGGGGAGGGGG + Intergenic
1168355412 19:55696917-55696939 CAGGGTGTCTGGAGGGTTGTCGG + Intronic
1168403503 19:56099171-56099193 CAGTGTGGCTCGAGGGCCCTGGG - Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168655728 19:58126157-58126179 AAGTGTGGATGGAGGGGCATTGG - Intergenic
1168671497 19:58244361-58244383 CAGTGTGGCTGTCGGGGTGTGGG - Intronic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
926163961 2:10506612-10506634 GAGTGTGGCAGGAGGGGTGCAGG - Intergenic
926381437 2:12294497-12294519 CAGAGTGACCGGAGGTGAGTGGG + Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
927336811 2:21934388-21934410 CAGTGATGGTGGAGGGGCGTGGG - Intergenic
927571887 2:24167211-24167233 CAGCGTGGGTGGAGAGGAGCTGG + Intronic
927788753 2:25993192-25993214 CAGTGTTGTTGGATGAGAGTAGG - Intergenic
927940394 2:27099804-27099826 CAGGCTGGATGGAGGGGAGAAGG - Exonic
928452979 2:31395290-31395312 CAGGATGGCTGGAGGGGGCTGGG + Intronic
929099769 2:38300689-38300711 CACTGAGGCTGGAGTGCAGTGGG + Intronic
929259682 2:39851760-39851782 CACTGTGGGTGCAGGGGAGAGGG - Intergenic
929396928 2:41534046-41534068 AAGTGTGGCTTGAGGCTAGTGGG + Intergenic
929723408 2:44396631-44396653 CACTGTTGGTGGAGGGGGGTAGG + Intronic
929768251 2:44868895-44868917 CAGTGTGTCAGGAGAGGACTGGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930511411 2:52349913-52349935 CAGTGTGGCTGCAACAGAGTGGG - Intergenic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
930889035 2:56361666-56361688 CAATGTGGCTGGAACAGAGTGGG + Intronic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
932680259 2:73818541-73818563 CACTGTGCCTCGAGGGGCGTGGG - Intergenic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933699454 2:85244148-85244170 CAGAGTGGCTGGAGCAGAGTGGG + Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935499555 2:103821668-103821690 CAGTGTGTCAGGAGCTGAGTGGG - Intergenic
935793454 2:106615522-106615544 CAGAGTGGCAGGAGTGGATTTGG + Intergenic
936145868 2:109980359-109980381 CAGCGTGGCTGGAGGGAGCTGGG - Intergenic
936198822 2:110391119-110391141 CAGCGTGGCTGGAGGGAGCTGGG + Intergenic
936444652 2:112586137-112586159 CAGTGTGGGGGGTGGGCAGTGGG + Intronic
937108423 2:119341388-119341410 CAGGGTGATTGGAGGTGAGTGGG - Intronic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937430706 2:121835784-121835806 AAGTATGGCTGGTGGGGTGTTGG + Intergenic
937466169 2:122134967-122134989 CATAGTGGCTGGAGCTGAGTGGG + Intergenic
937607275 2:123816261-123816283 CTGTGTGGCTGAAAAGGAGTGGG + Intergenic
938237376 2:129717308-129717330 CAGCGTGGCTGCAGGTGAGCTGG - Intergenic
938342385 2:130544249-130544271 CAATGTGGCTGCAAGGGAGCAGG + Intronic
938347447 2:130576460-130576482 CAATGTGGCTGCAAGGGAGCAGG - Intronic
938540647 2:132281228-132281250 CCGTGGGGCTGCAGGGGAGGGGG + Intergenic
939389201 2:141544704-141544726 CACTGAGGCTGGAGTGCAGTGGG + Intronic
939818100 2:146921437-146921459 CAGGGTGGGTGGATGGGAGGAGG + Intergenic
940165335 2:150764515-150764537 CAGTGTGGCTGGAAGAGGGGAGG - Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941422528 2:165300671-165300693 CTGAGTGGCTGGAGCAGAGTGGG + Intronic
941463590 2:165799738-165799760 CAGTTGGGCTGGAGGGGATTTGG - Intergenic
941874796 2:170421521-170421543 CAGGGTGGCTGGAGAGGGCTGGG - Intronic
942206992 2:173629097-173629119 CAGTGTGGCTGGATATGAGTGGG + Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943334782 2:186600307-186600329 TATTGAGGATGGAGGGGAGTGGG - Intronic
944973987 2:205026297-205026319 CAGGGTGGCTGCAGTGTAGTGGG + Intronic
946159093 2:217825314-217825336 GAGTGTGGCTAGAGGGAGGTGGG - Intronic
946217758 2:218198882-218198904 AAGTCTGGCTGAAGGGGAGGAGG - Intergenic
946236484 2:218327425-218327447 CAGCCTGGCAGGAGGGGAGCAGG + Intronic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
947459461 2:230290667-230290689 CAGTTTGGCTTGAGGGAAGGAGG + Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947865787 2:233397194-233397216 CAGGGTGGCTGGGGGGGGGGGGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948458421 2:238117946-238117968 GAGGGTGGATGGAGGGGAGGTGG + Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948647824 2:239419257-239419279 CAGAGATGCTGGAGGGGAGATGG + Intergenic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
948826401 2:240575306-240575328 CAGGGTGGCAGAAGGGGAGGTGG - Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168857432 20:1018584-1018606 CAGTGGGGCTGGAAAAGAGTGGG - Intergenic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169162814 20:3396712-3396734 CGGTATGGCTGGAGCAGAGTAGG + Intronic
1169275336 20:4229970-4229992 CAATGTGGCTGGAACAGAGTAGG - Intronic
1170199407 20:13726344-13726366 CAGTGTGGCTGGAGCATTGTCGG - Intronic
1170463289 20:16599265-16599287 CAGTTTGGCTGCAGGTAAGTAGG + Intergenic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1171050056 20:21849455-21849477 CTGTGTGGCTAGAGTGGATTGGG + Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171952863 20:31437055-31437077 CAGCGTGGCTGAAGAGTAGTGGG + Intergenic
1172165852 20:32898652-32898674 CGGTGGGGCTGGAAGGGAGGGGG + Intronic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1173361230 20:42346369-42346391 CAGTGTGACAGGTGGGGCGTGGG + Intronic
1173747088 20:45445971-45445993 CAGTGTGGCTGGGGCTGAGTGGG + Intergenic
1173787304 20:45803505-45803527 CAGTGTGGCTGGAGGTGGAGAGG - Intronic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1173988903 20:47284594-47284616 CAGAGTGGCTGGAAGGGGTTGGG - Intronic
1174081843 20:47975522-47975544 CAGCGTGGCAGGAAGGGAGCTGG - Intergenic
1174273628 20:49387387-49387409 GAGTCTGGCTGGAGGGGACTGGG + Intronic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174403845 20:50291292-50291314 CAGAGTGGCTGGTGGGGAGGTGG + Intergenic
1174514839 20:51083705-51083727 CAGTGTGGCTGGCAGAGAGTGGG + Intergenic
1174568789 20:51486304-51486326 CCCTGTGGCTGGACTGGAGTTGG - Intronic
1174979932 20:55382127-55382149 CAGTCTGGCTGGAAGGGCCTAGG + Intergenic
1175129183 20:56776438-56776460 CAGTGGCGCTGGAGGAGGGTGGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175853601 20:62107061-62107083 CAGAGTGGCTGGAGGGGCAGAGG - Intergenic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176061220 20:63173781-63173803 CAGTGTGGAGCGAGGGGAGCTGG - Intergenic
1176127703 20:63483334-63483356 CAGCGTGGCTGGAAGGGCCTGGG - Intergenic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1177228915 21:18293617-18293639 CAGAGTGGATGGAAGGGGGTGGG - Intronic
1178043817 21:28671593-28671615 CAGTGTGGTAGGAGTGGGGTGGG + Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179031537 21:37724555-37724577 TAGTGAGTGTGGAGGGGAGTGGG + Intronic
1179106538 21:38405508-38405530 CAATTAGGCTGGAGGGCAGTTGG + Intronic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179709999 21:43207897-43207919 CCATGTGGCTTGAGGGCAGTGGG + Intergenic
1179887644 21:44321199-44321221 CACGGTGGGTGGAGGGGAGGTGG + Intronic
1181020722 22:20100805-20100827 CAGTGTGGGAGGATCGGAGTAGG - Intronic
1181171188 22:21011220-21011242 CCGTGTGGCTGGAGTGGAAGAGG + Intronic
1181178157 22:21049299-21049321 CCGTGTGGCTGGAGTGGAAGAGG - Intronic
1181379386 22:22488320-22488342 CACTGTAGCTGGAAGGGAGTGGG + Exonic
1181382167 22:22514579-22514601 CACTGTAGCTGGAAGGGAGTGGG + Exonic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182659781 22:31917143-31917165 CAGCCTGGCTGGAGGGGATTAGG - Intergenic
1182686172 22:32122802-32122824 CATGGTGGGTGGAGGGGGGTGGG + Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183049052 22:35246047-35246069 CACTGTGGCTGGGTGAGAGTGGG + Intergenic
1183142950 22:35961547-35961569 CTGTGAGGTTGGTGGGGAGTTGG - Intronic
1183165528 22:36144539-36144561 CAGAGAGGCTGGAATGGAGTTGG - Intronic
1183171931 22:36194707-36194729 CAGAGAGGCTGGAATGGAGTTGG - Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183709498 22:39494546-39494568 CAGTGAGACTGGAGGGGCTTGGG + Intergenic
1183750958 22:39720021-39720043 CACTGTGGTTGGAGGGGACTGGG + Intergenic
1184109259 22:42385412-42385434 CCATGTGGCTGGAGGGCAATGGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184317337 22:43706176-43706198 CAGTGTTCCTGGAGCCGAGTTGG - Intronic
1184400930 22:44274053-44274075 CAGGGTGGGTGGGGGGGAGGGGG - Intronic
1184604505 22:45564455-45564477 CAGCGTGGCTCAAGGGAAGTGGG - Intronic
1184717546 22:46290533-46290555 CAGCGTGGCTGGAGGGTGTTAGG + Intronic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185330436 22:50249829-50249851 CAGGCTGGCTGCAGGGGGGTGGG - Intronic
1185347743 22:50317785-50317807 CTGTGTGGCAGGAGAGGAGCTGG - Intronic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950284760 3:11735906-11735928 CAGCGTGGCTGCAGTGGGGTTGG + Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950542344 3:13620042-13620064 CAGTGTGGCTGCATAGGAATGGG + Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950647994 3:14389167-14389189 CAGGGTGGCTGGGGGCGACTTGG - Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951031077 3:17882301-17882323 CACTGAGGCTGGAGTGCAGTGGG + Intronic
951707578 3:25558749-25558771 TAGGGTAGCTGGTGGGGAGTAGG - Intronic
952773468 3:37022608-37022630 TGGTTTGGCTGGTGGGGAGTGGG + Intronic
952777707 3:37061935-37061957 CAGTGTGGTTGAAGGGTTGTTGG - Intronic
952849930 3:37719545-37719567 CAGGGTGGGTGGAGGGGACATGG - Intronic
953114327 3:39976891-39976913 CGTTGTGGGAGGAGGGGAGTGGG + Intronic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
953799486 3:46011427-46011449 CAGTGTGGCTTGGAGGGACTGGG - Intergenic
954391859 3:50271739-50271761 CTGGGTGGCTGGAGGGGGTTGGG + Intronic
954778255 3:53039449-53039471 TAGGGTGGGAGGAGGGGAGTTGG + Intronic
955503825 3:59611381-59611403 CAGTGTGGCTGGAACACAGTGGG + Intergenic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
955833744 3:63031333-63031355 CAGGGTGGCTAGAGGGGATGGGG + Intergenic
955953360 3:64263985-64264007 CAGAGTGGCGGCAGGGCAGTGGG + Intronic
955961579 3:64346317-64346339 CGGTGTGGCTGGAGCACAGTGGG + Intronic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
956939952 3:74146957-74146979 CAGTTTGGAGGGAGGGTAGTGGG - Intergenic
957073850 3:75585966-75585988 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
959041213 3:101424706-101424728 CAATGTGGCTGATGGGGAGCAGG - Intronic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
960834941 3:121896518-121896540 GAGGGTGGGTGGAGGAGAGTAGG - Intronic
960882156 3:122356034-122356056 CAGTGAGGTTGGAGGTGAGCAGG + Intergenic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961657977 3:128453732-128453754 CAGTGTGGTTGGCGGGCAGGTGG + Intergenic
961772963 3:129263612-129263634 CAGGTTGGGTGGAGGGGACTCGG + Intronic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
962422508 3:135240866-135240888 CAATGTTGCTGCAGGGGAGGTGG - Intronic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964550108 3:157876177-157876199 CAGAGTAGCTGGACTGGAGTGGG - Intergenic
964751577 3:160058688-160058710 GAGTGGGGTTGGTGGGGAGTGGG + Intergenic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966519377 3:180855948-180855970 CACTGAGGCTGGAGTGCAGTGGG - Intronic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967570490 3:191022493-191022515 CACTGTGGCTGGAGGGGAACAGG + Intergenic
968615072 4:1574023-1574045 CAGTGTGGCTGCTGGGAAGGAGG - Intergenic
968862637 4:3184809-3184831 CAGACTGGCTGGAGAGGAGGAGG + Intronic
968917502 4:3503003-3503025 TGGTGTGGCTCGAGGGCAGTGGG - Intergenic
968945373 4:3660922-3660944 CACTGTGGCAGGAGGTGAGAGGG + Intergenic
969017434 4:4113276-4113298 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
969230734 4:5828464-5828486 GAGTGTGTCTGCAGGGGAGCGGG - Intronic
969335115 4:6503232-6503254 AGGTGTGGCTGGAGTGGGGTGGG - Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969442740 4:7226944-7226966 CCATGTGGCTGAAGGGCAGTGGG + Intronic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969795703 4:9526592-9526614 AAGTCTGGCTGGAGGAGAGTGGG - Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970173014 4:13308050-13308072 CAGTGTGGCTAGAGTGCGGTGGG - Intergenic
970214968 4:13749381-13749403 GTGTGTGTCTGGGGGGGAGTTGG - Intergenic
970272385 4:14360776-14360798 CAGTGTGCCGGGAGGGGGGGCGG + Intergenic
970515806 4:16829057-16829079 CAGTGAGGGAGGAGGGGAGTGGG - Intronic
971268831 4:25118282-25118304 CAGTTTGGCTGGAATGGAGCAGG + Intergenic
971489371 4:27194837-27194859 CAGAGTGGGTGAAGGGGAGATGG + Intergenic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
972445582 4:39140186-39140208 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
973832616 4:54776916-54776938 GAGTGTGGCTGGAATAGAGTGGG + Intergenic
975660000 4:76679270-76679292 TAGCGTGCCTGGAGGGCAGTGGG - Intronic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
976528242 4:86118381-86118403 CAGTGTGGCTGGAGAATTGTTGG - Intronic
976723882 4:88196971-88196993 CAGGATGGCTGGAGGGGTTTGGG - Intronic
976763613 4:88576417-88576439 CAGCATGGCTGGAGCAGAGTGGG - Intronic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
977679642 4:99784960-99784982 TAGTGTGGCTGGAGCAGAGCAGG - Intergenic
977891073 4:102312280-102312302 AAATGAGGCTGGAGTGGAGTGGG - Intronic
978871925 4:113589111-113589133 CAGTGTGGCTGGGGCTGAGTGGG + Intronic
979129260 4:117019975-117019997 TAGTGGGGCTGTAGGGGAGTGGG + Intergenic
979268506 4:118731986-118732008 CAGTGTGGCTGAAGTGGGATGGG + Intronic
979443009 4:120774657-120774679 CAGTGTGGCTGGGGTTGTGTTGG - Intronic
979615087 4:122733206-122733228 CAGTGTCGTTGGAGGGACGTGGG + Intronic
980002472 4:127506554-127506576 AAGTGAGGCTGGAGGAGATTTGG - Intergenic
980032495 4:127846328-127846350 CTGTGTGGCTGGGGTGGAGGAGG - Intergenic
980580791 4:134747373-134747395 GAGTGGGGGTGGGGGGGAGTGGG + Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982452601 4:155570788-155570810 CACTGTGGCTGGAGGTGGGGAGG + Intergenic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
984852406 4:184165439-184165461 CACCGTGGCTGGAGGGGAGCAGG - Intronic
984930122 4:184839600-184839622 AAGTGTGACTGCAGGAGAGTTGG - Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985272664 4:188208936-188208958 CAGTGTGGGGTGGGGGGAGTGGG - Intergenic
985822716 5:2170806-2170828 CACTGTGGCTGCAGGTGAGCAGG + Intergenic
985972673 5:3390823-3390845 CAGTGTGCATGGAGTGCAGTGGG - Intergenic
986173801 5:5334761-5334783 CAGTGCGGCTGGGAGGGAGCTGG - Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
987301765 5:16603851-16603873 CAGGGTGGCGGGTGGGGGGTGGG - Intronic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
989579184 5:43016312-43016334 CAGTGTGGTTGGAGGCGGGGTGG - Intergenic
990365414 5:55065697-55065719 CACAGTGGGTGGAGGGGAGTAGG - Intergenic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
991170306 5:63616731-63616753 AAGTGTGGTTAGAGGTGAGTGGG - Intergenic
991258084 5:64637452-64637474 CTGTGTGGAGGGAGGGGACTAGG + Intergenic
992381707 5:76243851-76243873 CAGTGTGGCTGCATGTGAGTTGG - Intronic
992879969 5:81098055-81098077 CAGCATGGCAGGAGTGGAGTTGG + Intronic
994802051 5:104390979-104391001 CATTGAGGTTGGAGGGGAGATGG + Intergenic
995655206 5:114418568-114418590 AAGTGGGGCTGGCGGGGAGTTGG + Intronic
996024142 5:118624905-118624927 TGGTGTGGCAGGAGGGGAGGTGG + Intergenic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
996693077 5:126361823-126361845 CACTGTGGCTGTGGAGGAGTTGG + Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997197711 5:131990797-131990819 CTGTGTGGCAGGGGTGGAGTGGG - Intronic
997198005 5:131992444-131992466 CAGAGTGGCTGCACCGGAGTAGG - Intronic
997356257 5:133265009-133265031 AAGTGTGGCTTCAGAGGAGTGGG - Intronic
997453396 5:134001222-134001244 CAGCCTGGCAGGAGTGGAGTTGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998391491 5:141789735-141789757 CAGAGTGGCTGGTGTGGACTTGG - Intergenic
998921336 5:147071506-147071528 CAGTGTGTCTGAAGTTGAGTAGG - Intronic
999143419 5:149377666-149377688 GGGTGTGGCTGGAGAAGAGTGGG + Intronic
999400363 5:151259393-151259415 AAGGCTGGCTGGAGAGGAGTGGG + Intronic
999450883 5:151677298-151677320 CTTTGTGGCTGCAGGGGAGATGG - Intronic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
999970836 5:156860760-156860782 GATGGTGGCTGGAGGAGAGTCGG - Intergenic
1000326662 5:160177527-160177549 CAGTGTGGCTGGATCAGAGGAGG - Intergenic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001485209 5:172115097-172115119 CAGTGTGGTGGGTGGGGAGATGG - Intronic
1001673122 5:173490927-173490949 CAGTGGAGCAGGTGGGGAGTGGG + Intergenic
1001679903 5:173548864-173548886 CAGTGTGGCTTGTGGGGATTGGG + Intergenic
1001929672 5:175664022-175664044 AAGTGTGGCTGGAGCCAAGTTGG + Intronic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002521066 5:179793527-179793549 CAGTGTGGCTGGGGGGGCGCTGG + Intronic
1002816231 6:683203-683225 CAGTCTTGCTGGAATGGAGTTGG - Intronic
1002872526 6:1179669-1179691 CAGTGTGGCTGGAGCAGGGGAGG - Intergenic
1002936858 6:1681495-1681517 CAGTGTGGCTCCAGGTGAGGAGG + Intronic
1003078790 6:3004443-3004465 CATTGTGGCTGAAGCTGAGTTGG - Intronic
1003118501 6:3299739-3299761 GAGTGTGGATGTATGGGAGTGGG + Intronic
1003171184 6:3723228-3723250 CAGGGTGGCTGGGGGGCACTAGG + Exonic
1003257256 6:4485308-4485330 CACTGTGGCTGGGGCAGAGTGGG - Intergenic
1003530154 6:6930360-6930382 CAGTCTGGCTGGGGCAGAGTAGG + Intergenic
1003627778 6:7758874-7758896 ATTTGTGGTTGGAGGGGAGTCGG + Intronic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004585373 6:16994630-16994652 CAGTGGGGCTCAAGTGGAGTGGG + Intergenic
1004698768 6:18058942-18058964 CAGTGTGGGTGCAGGACAGTGGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1005161695 6:22871527-22871549 CAGAAAGGCTGGAGGGGAGCTGG + Intergenic
1006042445 6:31267612-31267634 CAGGTGGGCTTGAGGGGAGTGGG - Intergenic
1006052033 6:31352701-31352723 CAGGTGGGCTTGAGGGGAGTGGG - Intronic
1006430616 6:33993446-33993468 GAGTGAGGCTGGAGAGGATTGGG + Intergenic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006547248 6:34790485-34790507 CAGTCCTACTGGAGGGGAGTGGG + Intergenic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1006966421 6:37990343-37990365 AACTGTGGCTTGAGGGGAGGGGG - Intronic
1007115980 6:39343622-39343644 CAGTGAGGTGGGAGGGGAGTAGG - Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008147746 6:47912120-47912142 CACAGATGCTGGAGGGGAGTGGG - Intronic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1010189165 6:73176754-73176776 CAGGCTGGCTTGAGGGGAGATGG + Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011734584 6:90297605-90297627 GAGAGTGGCTGGAAGGCAGTAGG - Intergenic
1012132840 6:95518910-95518932 CAGTGTGGCGAGAGGCGGGTGGG + Intergenic
1012146890 6:95695344-95695366 TAGTGTGGCTGCGGAGGAGTGGG + Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1013752720 6:113425694-113425716 CAGTGTGGTAGAAGGGGAATTGG + Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1014857530 6:126420237-126420259 CAGAGTGGCTGGATGTGAGATGG + Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1015816898 6:137220005-137220027 CAATGTGGCTGCAGTGGAATAGG - Intergenic
1016347020 6:143124747-143124769 CAGGGTGGCAGGACAGGAGTGGG + Intronic
1016835478 6:148472558-148472580 CAGAGTGGGTGATGGGGAGTTGG - Intronic
1016900316 6:149094285-149094307 GAGTTTGGATGGAGGAGAGTGGG + Intergenic
1017467471 6:154707787-154707809 CAGTCTGGCTGAAGTGGAGGAGG + Intergenic
1017889608 6:158627673-158627695 CAGCGTGGCTGGAGATGAGCAGG + Intronic
1018391695 6:163346068-163346090 CAGGGCTGCTGGAGGGGAATGGG - Intergenic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1018992275 6:168683234-168683256 CACTGTCTCTGGAGGGGAGGAGG - Intergenic
1019321084 7:415524-415546 AATTGTGGGAGGAGGGGAGTGGG + Intergenic
1019345191 7:526331-526353 CAGGGCAGCTGGAAGGGAGTGGG + Intergenic
1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG + Intergenic
1019492621 7:1322346-1322368 CAGTGAGCCTGGCAGGGAGTAGG - Intergenic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019778623 7:2926918-2926940 CAGTGTGGGTGGAGGAGGTTGGG + Intronic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1020147932 7:5659461-5659483 CAGTATGGCTGGAGCCCAGTGGG + Intronic
1021389589 7:20075155-20075177 CAGTGTGGGTGGTGGGGAGGGGG + Intergenic
1021813596 7:24426596-24426618 CAGTTTGGCTGGAAGGAATTAGG - Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022098155 7:27153652-27153674 GAGTATGGCTGGAGGGCAGGGGG - Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022408482 7:30116962-30116984 CAGTTTGGCTTCAGGAGAGTGGG + Intronic
1023045673 7:36208191-36208213 CTGTGTGACTGGATGGGGGTGGG + Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023282105 7:38581433-38581455 CAGTGTGGGTAGAGGGGAACTGG + Intronic
1023312492 7:38902340-38902362 CAGTGTGGCTGGAGGGTCACAGG - Intronic
1024558001 7:50620314-50620336 CAGTCTGGCTGCAGGAGAGGAGG - Intronic
1025076578 7:55949103-55949125 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1026735174 7:72944762-72944784 CAGTGTGGCTGCAGGAGTGGTGG + Intronic
1026785515 7:73299691-73299713 CAGTGTGGCTGCAGGAGTGGTGG + Intergenic
1026807163 7:73435769-73435791 CTGTGTGGCTAGAGGTGTGTGGG - Exonic
1026984379 7:74545844-74545866 CAGGGCGGCTGGAGGGGGGCCGG - Intronic
1027108557 7:75420245-75420267 CAGTGTGGCTGCAGGAGTGGTGG - Intronic
1027309341 7:76937867-76937889 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
1028106931 7:86889401-86889423 CACTGGAGCTGGGGGGGAGTTGG - Intronic
1028444426 7:90904070-90904092 CAGTCTGCCAGCAGGGGAGTGGG + Intronic
1028492787 7:91432362-91432384 CAGTGTGGGTGGAGGGGTCGAGG + Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1029959554 7:104675298-104675320 CAGAGAGGCTGGAGCAGAGTGGG + Intronic
1029996571 7:105013388-105013410 CAATGTGCGGGGAGGGGAGTGGG - Intergenic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1031675207 7:124601629-124601651 CAGTGTGGCTTTAGGTGATTGGG + Intergenic
1031895623 7:127345597-127345619 CAGTGTGGCTGCATTCGAGTGGG + Intergenic
1031915970 7:127563558-127563580 CAGTGTGATTGGCAGGGAGTTGG + Intergenic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1032105647 7:129026831-129026853 CACTCAGGCTGGAGGGCAGTGGG + Intronic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032482709 7:132259567-132259589 CAGTCTGGCTGGAGGGCCTTGGG - Intronic
1032491925 7:132330218-132330240 CAATTTGGCTGGAGCTGAGTAGG + Intronic
1032626310 7:133595078-133595100 CAGTGTGGATGGAGGAGTGTAGG + Intronic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1033169940 7:139075063-139075085 CAGTGGGGCTGGTGGGGGGGTGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035359455 7:158300771-158300793 CCGTGTGGAGGGAGGGGAGGTGG + Intronic
1036213760 8:6863141-6863163 TAGGGAGGCTGGTGGGGAGTGGG + Intergenic
1036241594 8:7086233-7086255 CAGTCTGGCTGAAGGAGAGTGGG - Intergenic
1036260244 8:7233884-7233906 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036312281 8:7692440-7692462 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036831141 8:12020844-12020866 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1038214741 8:25551175-25551197 CAGTGAGGCTGGACAGGTGTGGG - Intergenic
1038807631 8:30809894-30809916 CAGTCAGGCTGGAGTGCAGTGGG - Intronic
1039702871 8:39979393-39979415 CACTCAGGCTGGAGGGCAGTGGG + Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1040562195 8:48532929-48532951 AAGCCTGGCTGGAGCGGAGTGGG - Intergenic
1040638738 8:49306272-49306294 CAGTATGGCTGGTTGGGAGATGG - Intergenic
1040810578 8:51448280-51448302 AAGTGTGGGTGGTGGGGCGTGGG - Intronic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1042193395 8:66210863-66210885 CAGAGTGCCTGGAGGAGATTTGG - Intergenic
1042318785 8:67452905-67452927 CAATGTGGCTGGAGCCAAGTGGG + Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042542024 8:69916852-69916874 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1042679633 8:71368435-71368457 GAGAGTGGATGCAGGGGAGTGGG + Intergenic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1044792247 8:95859454-95859476 CACTTTGGCTGGTGGGGAGGAGG + Intergenic
1044804105 8:95987360-95987382 CAAGGTGGCTGGAGTGGAATGGG + Intergenic
1045002969 8:97894189-97894211 CAGTGTGTGTGGTGGGGTGTGGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045249628 8:100472686-100472708 CAGGGTGGATGGAGTTGAGTGGG - Intergenic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047325761 8:123834494-123834516 GGATGTGGCTGGAGAGGAGTCGG + Intergenic
1047536675 8:125726469-125726491 GAGAGTGGCTGGAGGTGAGATGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048978793 8:139691822-139691844 GGGTGTGGCTGGTGAGGAGTGGG - Intronic
1049310521 8:141931484-141931506 CAGTGGGGGTGGAGGTGTGTTGG + Intergenic
1049582767 8:143420389-143420411 CAGAGGGGCTGGACTGGAGTCGG - Intronic
1049586702 8:143435720-143435742 CTGTGTGCCTGGAGGGGTGCCGG - Intergenic
1049611862 8:143559582-143559604 CAGGGAGGCTGGATGGGAGAGGG + Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1049653018 8:143784215-143784237 CAGTGTTGCAGGAGGGGCCTGGG + Intergenic
1049780579 8:144426884-144426906 GAGTGTGGCTGGAAGGGCGCAGG - Intronic
1049829996 8:144694285-144694307 CAGTGTAGGTGGCGGGGAGTGGG + Intergenic
1049845212 8:144797485-144797507 AAGTGTGTGTGGAGGTGAGTGGG + Intergenic
1050495012 9:6231349-6231371 TAGTGTGGCTGGAGCAGAGCGGG - Intronic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051144796 9:14015658-14015680 CTGTGTGGCTGGGGTGGAGCTGG - Intergenic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052451259 9:28634444-28634466 AAGTGTGGGGGGAGGGGAGTTGG - Intronic
1052827484 9:33187549-33187571 CAGTGTGGCTGGCGCAGAGGAGG - Intergenic
1053121891 9:35553699-35553721 AAGTGTGGCTGGAGCACAGTGGG + Intronic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1055249585 9:74286988-74287010 CAATGTGGCTGGAGCAGGGTGGG - Intergenic
1055290775 9:74779829-74779851 CAATGTGGTTGGAGAGGAATGGG + Intronic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1056595717 9:88006579-88006601 CAGTGTGGCTGTGGGGGCGCTGG - Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1057363694 9:94398852-94398874 CACTGAGGCTGGAGTGCAGTGGG + Intronic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057659641 9:96989235-96989257 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1057987625 9:99733222-99733244 CAGAGTAGCGGGAGGAGAGTGGG + Intergenic
1057987751 9:99734436-99734458 CAGAGTAGCAGGAGGAGAGTGGG + Intergenic
1058178843 9:101771206-101771228 CAGTGTGTCAGAAGGGGAGTAGG - Intergenic
1058475381 9:105327707-105327729 CAGTGTGGATGAAAGGGGGTAGG - Intronic
1058940241 9:109806742-109806764 TAGTGTGGCAGGTGGGGAGTGGG + Intronic
1058972378 9:110095492-110095514 CTGAGTGGCTGAAGGGGAGCTGG - Intronic
1059434165 9:114266427-114266449 CGGTGTGGCTGGGGCGGACTAGG + Intronic
1059441458 9:114309354-114309376 CCGTGTGGCAGGAGGGCACTGGG + Exonic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060228800 9:121812388-121812410 CAGGGTAGCTGGAGAGGACTTGG + Intergenic
1060422650 9:123480371-123480393 AGGTGTGGCTGGAGGGGCCTTGG - Intronic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1060521642 9:124297457-124297479 CAGTGAGGCTGGCGGGGAGCTGG - Intronic
1060527515 9:124328800-124328822 CAGCGGGGCTGGCGGGGAGGGGG + Intronic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061002175 9:127908618-127908640 GGGTGTGGCCGGAGGCGAGTGGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061327663 9:129874060-129874082 CAGAGTGGCGGGAGGAGAGCTGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062062751 9:134505278-134505300 CTGTGTGGATGGGGGGGTGTGGG + Intergenic
1062207387 9:135344716-135344738 CAGGGTGGCTGCAGGGCTGTGGG + Intronic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1185979807 X:4765383-4765405 CAGTGTGGTTCGAGGGGAGGAGG + Intergenic
1186403118 X:9277891-9277913 TAGTATGGCTGGAGGGGACGTGG - Intergenic
1186613213 X:11159132-11159154 CTGTGAGGCTGGAAGAGAGTAGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1188580034 X:31700366-31700388 CAATGTGTATGGAGAGGAGTTGG + Intronic
1189244671 X:39554336-39554358 TAGTGTGGCTGGAGCAGAGCGGG + Intergenic
1189338681 X:40187487-40187509 CAGAGTGGATGGAGGGAAATGGG + Intergenic
1190342480 X:49308582-49308604 CAGAGTGGCTGGGGGGCAGCAGG + Intronic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1191072993 X:56421633-56421655 GAGAGTGGGTGCAGGGGAGTGGG - Intergenic
1192175314 X:68881306-68881328 CCCTGAGGCTGGAGGGGAGGGGG + Intergenic
1192903140 X:75521854-75521876 CACTGTGGGAGGTGGGGAGTGGG + Intronic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193980513 X:88176311-88176333 CAGGGTGGCTGCATGTGAGTGGG - Intergenic
1194016200 X:88624640-88624662 CAGTGTGGCTAGAGGAGTGCAGG + Intergenic
1194887914 X:99340865-99340887 GAGGGTGGCTGGAGGGGAGGTGG - Intergenic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196704992 X:118709825-118709847 CTGAGTGACTGGAGTGGAGTGGG - Intergenic
1197335669 X:125206459-125206481 CGGTGGGGCGGGACGGGAGTGGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197837552 X:130711640-130711662 GAGTGTGGCAGGGTGGGAGTTGG + Intronic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200174001 X:154099062-154099084 CAGTGTTGCTGGAGAGTGGTAGG + Intergenic
1201463836 Y:14257813-14257835 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic