ID: 1184148798

View in Genome Browser
Species Human (GRCh38)
Location 22:42626953-42626975
Sequence AGATGGGCCCCTCCATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184148791_1184148798 27 Left 1184148791 22:42626903-42626925 CCTGACACCCTGTAGCTCAGGGG No data
Right 1184148798 22:42626953-42626975 AGATGGGCCCCTCCATGTCCAGG 0: 1
1: 0
2: 0
3: 17
4: 204
1184148789_1184148798 28 Left 1184148789 22:42626902-42626924 CCCTGACACCCTGTAGCTCAGGG 0: 1
1: 0
2: 2
3: 17
4: 178
Right 1184148798 22:42626953-42626975 AGATGGGCCCCTCCATGTCCAGG 0: 1
1: 0
2: 0
3: 17
4: 204
1184148794_1184148798 19 Left 1184148794 22:42626911-42626933 CCTGTAGCTCAGGGGCTTCGTGC 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1184148798 22:42626953-42626975 AGATGGGCCCCTCCATGTCCAGG 0: 1
1: 0
2: 0
3: 17
4: 204
1184148793_1184148798 20 Left 1184148793 22:42626910-42626932 CCCTGTAGCTCAGGGGCTTCGTG 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1184148798 22:42626953-42626975 AGATGGGCCCCTCCATGTCCAGG 0: 1
1: 0
2: 0
3: 17
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184148798 Original CRISPR AGATGGGCCCCTCCATGTCC AGG Intronic
900336522 1:2166710-2166732 GAAGGTGCCCCTCCATGTCCTGG - Intronic
900475379 1:2873991-2874013 GGATGGGCCCCTGCCTGCCCTGG - Intergenic
901448418 1:9321992-9322014 AGATGGGCCCAACCATCCCCAGG + Intronic
902177157 1:14659092-14659114 AGATGTGCACCGCCATGCCCAGG - Intronic
902828195 1:18991900-18991922 AGATGGCCCCCTCTAGGTCTGGG - Intergenic
903233449 1:21935664-21935686 TGAGGGGCTCCTCCATGCCCGGG - Intronic
903676793 1:25069345-25069367 AGGTGGGCCTCTCCATGGCATGG + Intergenic
903840246 1:26233909-26233931 AGCAGGGCCCCTCCAGGTCTAGG + Intergenic
905350550 1:37343382-37343404 AGACAGGCCCCACCATGTCCCGG + Intergenic
905919938 1:41712725-41712747 AGCTGGTCCCCTGCATGGCCCGG + Intronic
907388299 1:54139945-54139967 TGTTGGGCTCCTCCAGGTCCAGG + Exonic
907582142 1:55582139-55582161 AGAAGGGCCCACCCTTGTCCAGG - Intergenic
909474971 1:76072353-76072375 AGATGGACCACTCGATGTCTGGG - Intergenic
910890436 1:92013072-92013094 AGATGTGCACCGCCATGCCCAGG - Intronic
913103813 1:115594166-115594188 AGCTGGGCTGCTCCAAGTCCAGG + Intergenic
916059030 1:161086439-161086461 GGATGGGCCCCTCCCTTTCAAGG + Intronic
916755827 1:167769471-167769493 ATGTGAGCCCCTCCATGTCATGG + Intronic
921246737 1:213251248-213251270 AGATGGCCACCACCATGCCCTGG + Intronic
922619483 1:226981211-226981233 ATAGGGGCACCTCCATGTCTAGG + Intronic
1063676082 10:8141520-8141542 AGATGGTCCTCACCTTGTCCAGG - Intergenic
1065205687 10:23355787-23355809 AGCTGTGCGCCACCATGTCCAGG - Intergenic
1067451212 10:46383200-46383222 AGACAGGCTGCTCCATGTCCTGG - Intronic
1067586030 10:47476551-47476573 AGACAGGCTGCTCCATGTCCTGG + Intronic
1068315485 10:55336352-55336374 AGGTGGGCACCACCATGCCCAGG - Intronic
1070659875 10:78297648-78297670 AGCTGTGCGCCACCATGTCCAGG + Intergenic
1071770923 10:88728252-88728274 AGATGATGCCATCCATGTCCAGG - Intronic
1071975144 10:90948028-90948050 AGATGTGCACCACCATGCCCAGG + Intergenic
1075442876 10:122493777-122493799 AGGTGGGGCCCTCAAGGTCCTGG - Intronic
1077332408 11:1989360-1989382 TGATGCCCCCCTCCACGTCCAGG - Intergenic
1077732890 11:4752904-4752926 ACATGGGCCCATTCAAGTCCAGG + Intronic
1078356000 11:10631841-10631863 AGATCAGCCCCTCCGTGTCTGGG - Intronic
1078769186 11:14331558-14331580 AGATGTGCGCCACCATGCCCAGG - Intronic
1079078241 11:17396752-17396774 AGATGGGCCCCCACAGGCCCAGG + Intronic
1080645164 11:34182802-34182824 AGATGAGCCACTAGATGTCCAGG - Intronic
1083752662 11:64769470-64769492 AGATGAGCCACTTCATGCCCTGG - Exonic
1084176398 11:67424544-67424566 AGCTGGGCCCATCGATGCCCAGG - Exonic
1088086030 11:105981629-105981651 ACATGAGCCCCTTCATGACCTGG + Exonic
1089286476 11:117411056-117411078 TGAGGCGCCCCTCCATGACCAGG + Intronic
1089314554 11:117582699-117582721 AGCCGGGCCCCTCCAGCTCCGGG + Intronic
1089455125 11:118621480-118621502 AGCTCGGGCCCTCCAGGTCCCGG - Intronic
1089601225 11:119616602-119616624 AGCTGGGATACTCCATGTCCAGG + Intergenic
1089635084 11:119806904-119806926 AGAAGGGCACTTCCATGTCCAGG - Intergenic
1090029403 11:123194760-123194782 AGATGTGCTCCTCCGTGGCCAGG + Intronic
1090632724 11:128664375-128664397 AGATGGGCCCCTGCAGGTTGTGG - Intergenic
1202815389 11_KI270721v1_random:44536-44558 TGATGCCCCCCTCCACGTCCAGG - Intergenic
1092841779 12:12549400-12549422 AGCTGGGCTCCCCCATGTGCTGG - Intronic
1095480157 12:42626324-42626346 AGACGTGCACCACCATGTCCAGG + Intergenic
1095801089 12:46269892-46269914 AGCTGGGGCGCTCCAAGTCCGGG + Intronic
1096095950 12:48935840-48935862 ACATGGGGCCCTCCAAGTTCAGG + Exonic
1096868641 12:54579618-54579640 ATCTGGGCCCCTCAATGTCTAGG + Exonic
1102495601 12:113316859-113316881 AGATGGGGCCCTCCAAGACCTGG - Intronic
1102872143 12:116422381-116422403 AGCTGGGCTCCTTCATGTTCTGG - Intergenic
1103144965 12:118587666-118587688 AGGTGTGCACCACCATGTCCAGG + Intergenic
1104971061 12:132530894-132530916 AGATGGGCCCTGCCATGTGCAGG + Intronic
1107225968 13:38047452-38047474 AGATGAGCACCACCATGTCCAGG - Intergenic
1111097633 13:83535553-83535575 AGTTGGGCCGCTCGATGGCCCGG - Intergenic
1111331265 13:86763534-86763556 AGGTTGGCTCCTCCAAGTCCTGG - Intergenic
1111668574 13:91300289-91300311 AGATGGGACCATCCAGGTTCAGG + Intergenic
1112072792 13:95873646-95873668 AGATGGAGCCCTTCCTGTCCAGG + Intronic
1113510550 13:110850971-110850993 AGCTGGCCCCCTCCATTTTCGGG - Intergenic
1114536913 14:23428766-23428788 GGCTGGTCCCCTCCATGTCAAGG + Intronic
1115097142 14:29650384-29650406 GGATAGGCCCTCCCATGTCCCGG - Intronic
1118209202 14:63751001-63751023 AGAGGGGCCCCCCCACCTCCCGG + Intergenic
1118317829 14:64736640-64736662 AGGCGGGCCCATCCATCTCCAGG - Intronic
1118643573 14:67816496-67816518 AGAGGGGCCCCTCCCTCTCAGGG + Intronic
1119719935 14:76883765-76883787 AGATAGGCCCCTCCCTGCCAAGG + Intergenic
1121146492 14:91587667-91587689 AGATGTGCTCGTCCATATCCAGG + Intronic
1121272535 14:92647908-92647930 AGAAGGGCCCATCCTTGCCCTGG - Intronic
1122743666 14:103885850-103885872 ACTTGGGCCACTCCATGTCAGGG - Intergenic
1122792955 14:104192183-104192205 ATCGGGGCCCCTCCATGTCCAGG + Intergenic
1123003730 14:105311395-105311417 AGATGCGCACCACCATGCCCAGG + Exonic
1123751921 15:23363674-23363696 AGATGTCCTCCTCCATCTCCTGG - Exonic
1124284287 15:28387598-28387620 AGATGTCCTCCTCCATCTCCTGG - Exonic
1124298410 15:28524016-28524038 AGATGTCCTCCTCCATCTCCTGG + Exonic
1128791831 15:70439849-70439871 AGATGGGCCCCGCCATTAACAGG - Intergenic
1130030901 15:80312783-80312805 AGATGCTCCCATCCATGTCAAGG - Intergenic
1132746199 16:1437319-1437341 CGCTGGGCCCCTCCCTGTCTCGG - Intronic
1134627841 16:15735511-15735533 AGATGTGGCCCTCCAGCTCCCGG + Exonic
1136284172 16:29231537-29231559 GGCTGGGCCCCTCTGTGTCCCGG + Intergenic
1137351101 16:47714522-47714544 AGATGTGCTCCTCCAGGTGCAGG - Intergenic
1137380368 16:47993040-47993062 AGATGGGCACCCCCACCTCCAGG + Intergenic
1138167992 16:54820534-54820556 AGATAGGCCCCTCCACCTTCAGG - Intergenic
1138320239 16:56105424-56105446 AGATGGTGCCCTCTATGTACAGG - Intergenic
1138552806 16:57756632-57756654 AGCTGGGTTCCTCCATGGCCTGG + Intronic
1139558036 16:67724995-67725017 AGGTGGGCCACCCCAAGTCCTGG + Exonic
1139594439 16:67949807-67949829 AGATGGGGGCCACCATGTCGAGG + Exonic
1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG + Intronic
1142940907 17:3379268-3379290 AGGTTGGCCCCTCCAGATCCAGG + Intergenic
1144849755 17:18238091-18238113 AGAGCGGACCCTCCATGGCCAGG - Exonic
1147234158 17:39044859-39044881 AGAAGGGCCCCACAATGTCTCGG - Intergenic
1147717586 17:42518857-42518879 AGATGGGGCCCCCCTTGCCCTGG + Intronic
1148340840 17:46872572-46872594 AGGTGGGCCCCGCCCTGTGCCGG - Exonic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150623400 17:66824719-66824741 AGAGGGGCCCCAGCATGCCCAGG + Intergenic
1151706931 17:75774100-75774122 GGATGCGCCCCACCATGTTCTGG - Intergenic
1154129881 18:11727453-11727475 AGGTGGGCACCACCATGCCCAGG - Intronic
1154446225 18:14437886-14437908 AAGAGGGCCCCTCCATGGCCTGG + Intergenic
1155369205 18:25080104-25080126 CCTTGGGCCCCTCCATGTCTGGG - Intronic
1158760924 18:60385670-60385692 AGAAGGGCTACTCCATGTGCTGG - Intergenic
1159518981 18:69495064-69495086 GGATGGGCACCTCCAGGTGCTGG + Intronic
1160831530 19:1106822-1106844 CCAGGGGCCCCTCCATGTCAGGG + Intergenic
1161659204 19:5535710-5535732 AGATGTGCACCACCATGCCCAGG - Intergenic
1162541536 19:11299352-11299374 TGATGGGCCCCTCCATCACTGGG - Intronic
1162593636 19:11610226-11610248 AGAATGCCCCCTTCATGTCCAGG - Intronic
1163257117 19:16163031-16163053 AGGTGTGCCCCACCATGCCCAGG + Intronic
1164065258 19:21709363-21709385 TGAGGGGCGCCGCCATGTCCTGG + Intergenic
1164598914 19:29548193-29548215 AGATGGCTGCCTCCGTGTCCAGG - Intronic
1165160661 19:33813781-33813803 AGATGGGCCCCTTCATGGTGGGG - Exonic
1165243305 19:34483441-34483463 ACCTGGGCCACTCCATCTCCCGG - Intronic
1166641692 19:44499585-44499607 AGAGGGCCCCCTGCACGTCCTGG - Intronic
1167710139 19:51105355-51105377 AGATGGGCCGATCCATGTCTTGG - Intronic
1168251032 19:55142027-55142049 AGCTGGGACCCTCCACGTTCAGG - Intronic
1168599177 19:57704568-57704590 TGATTGTCCCCTCCATGTCTGGG - Intronic
927154303 2:20212845-20212867 AGACGGACCCCTCACTGTCCTGG + Intronic
928907762 2:36385554-36385576 AGAGGGGCCTCTGCTTGTCCTGG + Intronic
932574670 2:72956117-72956139 TGATGGGCCCATCCATGTTTGGG + Intronic
932783711 2:74580937-74580959 AGATGGGCCCATCTATCTGCAGG + Intronic
933800332 2:85955294-85955316 ACATGGGCCCATCCATGGTCAGG + Intergenic
937887807 2:126912001-126912023 AGTTGGGCCCCTCCAAGTTGGGG + Intergenic
937915471 2:127096793-127096815 AGAAGGGCCCCTGCTTGCCCTGG + Intronic
943202034 2:184840244-184840266 AGGTGGGTGCCACCATGTCCAGG - Intronic
943419627 2:187654709-187654731 AGACTGGCCCCTCCTTTTCCTGG + Intergenic
943813185 2:192216339-192216361 AGATGAGGCACTACATGTCCAGG + Intergenic
944543728 2:200778863-200778885 AGATGTGCACCACCATGGCCAGG - Intergenic
947105826 2:226667108-226667130 AGGTGGGCACCACCATGCCCAGG - Intergenic
948747648 2:240107902-240107924 AGAGTGGCCACTCCATCTCCTGG - Intergenic
1172106392 20:32519645-32519667 AGATGGGCCCCCAGATTTCCTGG + Intronic
1172676643 20:36677235-36677257 GGAAGGGCCCCTCCAAGCCCCGG + Intronic
1173443304 20:43096504-43096526 AGCTGGGCCCCTCCTCCTCCTGG + Intronic
1174189292 20:48728716-48728738 AGAAGGGCCCATCTTTGTCCAGG + Intronic
1174844472 20:53929824-53929846 AGATTGTCCCCTCCTTGACCTGG - Intergenic
1175486716 20:59352136-59352158 CAATAGGCCCCTCCCTGTCCTGG - Intergenic
1176449757 21:6851960-6851982 AAGAGGGCCCCTCCATGGCCTGG - Intergenic
1176827929 21:13716984-13717006 AAGAGGGCCCCTCCATGGCCTGG - Intergenic
1178662880 21:34521741-34521763 AGATGGGCAGGTCAATGTCCAGG + Intronic
1179165710 21:38933702-38933724 AGGAGGGCCCCTCCATCTCCTGG - Intergenic
1179923971 21:44522397-44522419 AGGTGGGGCCCACCGTGTCCTGG + Intronic
1180119044 21:45734340-45734362 ACATGTGCCCATCCATGTCCAGG + Intronic
1180419398 22:12799748-12799770 AGGTGGGCCACTCCAGGTACTGG - Intergenic
1180762525 22:18220944-18220966 GGATGGCCTCCTCAATGTCCCGG - Intergenic
1180773142 22:18403664-18403686 GGATGGCCTCCTCAATGTCCCGG + Intergenic
1180804497 22:18653213-18653235 GGATGGCCTCCTCAATGTCCCGG + Intergenic
1180806253 22:18716197-18716219 GGATGGCCTCCTCAATGTCCCGG - Intergenic
1180985338 22:19900972-19900994 AGCTGGGCCCCTGCACGTCAGGG + Intronic
1180986268 22:19905607-19905629 TGCTGGGCCCCTCGATGTACTGG - Intronic
1181170874 22:21009161-21009183 ACATGGGACACTCGATGTCCAGG + Intergenic
1181180896 22:21067668-21067690 ACATGGGACACTCGATGTCCAGG - Intergenic
1181217200 22:21341978-21342000 GGATGGCCTCCTCAATGTCCCGG - Intergenic
1181672546 22:24432467-24432489 AGAAAGGCCCCTCCCTGCCCAGG - Intronic
1183489579 22:38109326-38109348 AGATGGGCCCCCCAAAGTCTGGG - Intronic
1183671809 22:39277595-39277617 AAATGGGCTCGTCCAAGTCCAGG + Intergenic
1184148798 22:42626953-42626975 AGATGGGCCCCTCCATGTCCAGG + Intronic
1184197564 22:42940606-42940628 AGAGGGGCCACCCCAGGTCCTGG + Intronic
1184649022 22:45911205-45911227 AGATGCTGCCCTCCAAGTCCGGG + Intergenic
1185036932 22:48484396-48484418 AGATGGGCCCCTCCAGCTGCTGG - Intergenic
1185143455 22:49116806-49116828 CCAGGGGCCCCTCCATGTGCTGG + Intergenic
1185163686 22:49244696-49244718 AGAGGTGCCCCTCAGTGTCCTGG - Intergenic
1203234974 22_KI270731v1_random:144646-144668 GGATGGCCTCCTCAATGTCCCGG + Intergenic
949535155 3:4989621-4989643 AGATGGGGCCCTCCCTTCCCTGG + Intergenic
952821334 3:37488652-37488674 AGATGCACCCCACCATGCCCAGG - Intronic
954090447 3:48279722-48279744 TGAGGGGTCCCTTCATGTCCTGG + Intronic
956334894 3:68152740-68152762 AGGTGGCCCCCACCATCTCCAGG + Intronic
958055974 3:88412394-88412416 GGATGAGCCTCTCCTTGTCCAGG - Intergenic
962783187 3:138740794-138740816 AGATGTGCACCACCATGCCCAGG + Intronic
965849692 3:173009420-173009442 AGAGGGGCTCTTCCATGGCCAGG - Intronic
967986665 3:195100387-195100409 AAATGTGTCCCTCCTTGTCCTGG - Intronic
969428539 4:7139679-7139701 AGAGCAGCCCCACCATGTCCCGG - Intergenic
969471692 4:7392880-7392902 ATATGGGCCCCTCCCAGTCGGGG + Intronic
969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG + Intronic
969896587 4:10310891-10310913 AGATGTGTCTCTCCATGTACAGG - Intergenic
970329143 4:14961380-14961402 ATCTGGGCCCCTCCATCTTCAGG + Intergenic
978944044 4:114472732-114472754 AGGTGGGCAGCTCCATGTGCTGG - Intergenic
981049075 4:140293267-140293289 AGATGGGCTCCTCCTTGTCAGGG + Intronic
985874345 5:2584133-2584155 AGAGGTGCCAGTCCATGTCCAGG - Intergenic
987889938 5:23864022-23864044 AGCCGGGCCCCTCCTTTTCCTGG + Intergenic
988769371 5:34415898-34415920 AGAAGGGCCACTACATGTCATGG - Intergenic
990304734 5:54482796-54482818 AGATGGCCCTCTCCAAGTGCTGG - Intergenic
990865818 5:60378707-60378729 AGATGGGCACCACCATGCCCTGG - Intronic
992084844 5:73269272-73269294 TGATGGGCCATTCCAGGTCCTGG + Intergenic
993122152 5:83788800-83788822 AGATGGGCCCTTGCCTTTCCAGG - Intergenic
993221758 5:85107758-85107780 AGATGGCCACCTCAATTTCCAGG - Intergenic
996879400 5:128277853-128277875 CGATGGGCACCTCTATATCCAGG - Intronic
997205313 5:132044840-132044862 AGGTGTGCACCACCATGTCCTGG - Intergenic
1002054951 5:176593507-176593529 AGAGCCACCCCTCCATGTCCAGG - Intronic
1002119763 5:176993465-176993487 AGATGTGAGCCTCCATGCCCAGG + Intronic
1002402123 5:178996665-178996687 GGATGGGCCCTTCCCTGTTCAGG + Intergenic
1005601547 6:27431262-27431284 AGATAGGCCCCTCCAGGTCATGG - Intergenic
1006613462 6:35309801-35309823 AGCTGGGCCCCACCTTGTCCAGG - Exonic
1016389180 6:143557966-143557988 GGATGGGATCCTTCATGTCCAGG + Intronic
1016494786 6:144648595-144648617 AGATGGGAGCCTCTCTGTCCTGG + Intronic
1017880809 6:158561007-158561029 ATATGGGCCACTCCTTCTCCCGG - Intronic
1019077937 6:169405468-169405490 AGATGGCCCTCTCCATCTCAGGG - Intergenic
1019952750 7:4386949-4386971 AGATGTGTGCCACCATGTCCAGG - Intergenic
1020136400 7:5590430-5590452 CGATGGGCACCTCTGTGTCCGGG - Intergenic
1023367406 7:39477342-39477364 AGCTGGGCCCCTCCTCTTCCTGG - Intronic
1024122114 7:46254015-46254037 AAGTGGGCACTTCCATGTCCTGG - Intergenic
1024462886 7:49678280-49678302 AGATGTGGCCCTTCATGGCCTGG - Intergenic
1028911232 7:96209649-96209671 AGATGGGCCACTGAATGTGCTGG + Intronic
1029490430 7:100867491-100867513 AGGTGGGCCCCGACATGGCCTGG - Exonic
1032676525 7:134134651-134134673 ATCTGGCCCCCTCCATTTCCTGG - Intronic
1034831759 7:154314602-154314624 AGCTGGGCTCCCCCATGCCCTGG - Intronic
1036507456 8:9368487-9368509 AGAAGGGCCCTTCCAAGGCCGGG + Intergenic
1036654833 8:10671413-10671435 AGAAGGGGGTCTCCATGTCCAGG - Intronic
1037776384 8:21838586-21838608 GGCTGGGCCCATCCAGGTCCAGG + Intergenic
1038959768 8:32506104-32506126 AGATGTACACCACCATGTCCAGG - Intronic
1039029790 8:33296976-33296998 AGATGGGCCCTTCCATCTTCAGG - Intergenic
1039711595 8:40061195-40061217 AGAGGGGCCCCACCCTTTCCAGG + Intergenic
1040387302 8:46922159-46922181 TGATGGGCACCTCCCTGGCCAGG - Intergenic
1042878798 8:73465171-73465193 AGCTGGGCCCCTCAATTTCCCGG + Intronic
1048962917 8:139594994-139595016 AGATGGACCACTCCATGACAAGG + Intergenic
1049433457 8:142575726-142575748 AGATGGGCCCCTGCTGATCCCGG - Intergenic
1053508957 9:38670643-38670665 AGAAGAGCCCATCCATTTCCTGG - Intergenic
1060918277 9:127403893-127403915 AGCTGGGTCCCTCCCTCTCCAGG - Intronic
1061731111 9:132614715-132614737 AGCTGGGCACCTACATCTCCTGG - Intronic
1062011314 9:134268358-134268380 TGATGGCCGCCTCCGTGTCCTGG - Intergenic
1062630158 9:137459738-137459760 AGAGGGGCCCGTCCTGGTCCTGG + Intergenic
1203519427 Un_GL000213v1:32557-32579 AAGAGGGCCCCTCCATGGCCTGG + Intergenic
1186068063 X:5787869-5787891 AGCTAGGCCCCTCCCTTTCCTGG - Intergenic
1189151697 X:38715350-38715372 AGATGGGTTTCACCATGTCCAGG + Intergenic
1192529029 X:71870619-71870641 AGATGGTGGCATCCATGTCCAGG - Intergenic
1196300825 X:114048100-114048122 AGATGGGCGCCACCATGCACAGG - Intergenic
1197694235 X:129533659-129533681 AGATGTGCACCACCATGTCTAGG - Intergenic