ID: 1184149228

View in Genome Browser
Species Human (GRCh38)
Location 22:42628845-42628867
Sequence ATGGAGAAGGGGAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1248
Summary {0: 1, 1: 0, 2: 8, 3: 124, 4: 1115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184149221_1184149228 -6 Left 1184149221 22:42628828-42628850 CCCAAGGAGTCTGATGGATGGAG 0: 1
1: 0
2: 3
3: 21
4: 137
Right 1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG 0: 1
1: 0
2: 8
3: 124
4: 1115
1184149222_1184149228 -7 Left 1184149222 22:42628829-42628851 CCAAGGAGTCTGATGGATGGAGA 0: 1
1: 0
2: 2
3: 17
4: 244
Right 1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG 0: 1
1: 0
2: 8
3: 124
4: 1115
1184149219_1184149228 -2 Left 1184149219 22:42628824-42628846 CCTGCCCAAGGAGTCTGATGGAT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG 0: 1
1: 0
2: 8
3: 124
4: 1115
1184149218_1184149228 -1 Left 1184149218 22:42628823-42628845 CCCTGCCCAAGGAGTCTGATGGA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG 0: 1
1: 0
2: 8
3: 124
4: 1115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184149228 Original CRISPR ATGGAGAAGGGGAAGGTGGC TGG Intronic
900140531 1:1137779-1137801 AGGGAGAGGGGGAGGGAGGCGGG - Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900345302 1:2207654-2207676 GTGGAGAAGGGGACCCTGGCAGG + Intronic
900979312 1:6037334-6037356 TTGCAGAAGGGGATGGGGGCTGG - Intronic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901395906 1:8981409-8981431 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
901508374 1:9700977-9700999 AGGGGGCAGGGGAAGGAGGCCGG - Intronic
901840251 1:11949800-11949822 GTGGAGAAGGGGACGTCGGCAGG + Exonic
902216144 1:14935683-14935705 AGGGAGAAGGGGAAGGGAGAGGG - Intronic
902758656 1:18566578-18566600 ATGTAGATGGTGAAGGTGGGTGG + Intergenic
902770739 1:18644074-18644096 CTGGAAGAGGGGAAAGTGGCCGG - Intronic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
904419812 1:30384366-30384388 GTGGGGAGGGGGAAGGTGCCAGG + Intergenic
904911475 1:33937454-33937476 ATGGGGAAGTGGAAGTGGGCAGG + Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905227152 1:36486782-36486804 ATGGAGGAGGGGCGGGAGGCAGG - Intergenic
905313572 1:37066870-37066892 ATGAAGATGGGGAAGGAGGGAGG - Intergenic
905481776 1:38266703-38266725 ATGGGAAAGGGGATGGTGTCGGG + Intergenic
905481926 1:38267798-38267820 AGGGAGGAAGGGAAGGAGGCGGG - Intergenic
905486506 1:38301090-38301112 ATGGAGAAGGGGCAGGTTGAAGG + Intergenic
905550184 1:38831232-38831254 ACAGAGAAGAGGAAGCTGGCAGG + Intergenic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
905942436 1:41874837-41874859 CTGGAGAAGGGAAAGGTAGCTGG - Intronic
906270341 1:44472880-44472902 AGGGAGAAAGGCAAGGTGGCAGG - Intronic
906522181 1:46474166-46474188 ATGGAGGAGGTGAAGGTGATGGG + Intergenic
906774059 1:48512723-48512745 ATGGAAAAGGGGCAGGTAGGAGG - Intergenic
907162876 1:52384263-52384285 ATGGAAAAGGGGTCCGTGGCAGG - Intronic
907338414 1:53715877-53715899 GTGGAGAATGGGGCGGTGGCAGG + Intronic
907547456 1:55274699-55274721 ATGGAGAAGAGGGAGGTAGCAGG - Intergenic
907671808 1:56480979-56481001 ATGAAGGAGGGGAAGGTCACAGG + Intergenic
907765730 1:57408826-57408848 ATGGAGCAGGGGAAGGGGCCAGG - Intronic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
907931735 1:59007107-59007129 ATGGAGGAGGGGCTGCTGGCAGG - Intergenic
907963629 1:59307827-59307849 AGGGAGAAGGGAAAGGGAGCTGG - Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
909288786 1:73855696-73855718 TTAGAGAAAAGGAAGGTGGCAGG + Intergenic
909433990 1:75619127-75619149 AGGGAGAGCGGGAAGGAGGCAGG + Intergenic
909506095 1:76391582-76391604 AAGGGGAAGGGGAAGGTGAAAGG - Intronic
910049987 1:82962090-82962112 ATTGAGATGCGGAAGGTTGCAGG + Intergenic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
911036396 1:93553821-93553843 AGGGAGATGGGGCAGGTGGGGGG + Exonic
911054162 1:93696563-93696585 ATGGAGAAGGGCAGGATGGGAGG - Intronic
911103973 1:94115913-94115935 ATGGAGCAGGGGACGGTGTGTGG - Intronic
911308761 1:96266475-96266497 AGGGAGGATGGGAGGGTGGCAGG + Intergenic
911627335 1:100139529-100139551 ATGGAGGAAGGGAGGATGGCAGG + Intronic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912308498 1:108595508-108595530 ATGGAGAAAGGGAGGGAGGGAGG + Intronic
912666011 1:111580328-111580350 ATGGAGCATGGGAAGGTGGGAGG + Intronic
912734873 1:112141761-112141783 CGGGAGAAGGGGCAGGTGCCTGG + Intergenic
912755600 1:112322176-112322198 AGTGAGAAGGGGAAGGAGACAGG + Intergenic
912913742 1:113790170-113790192 ATGGAGAAGGGAAAGGTTGGAGG + Intronic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
913369682 1:118084097-118084119 AAGGAGAAGTGGAGGGTGGCAGG + Intronic
914916130 1:151820246-151820268 GGGGAGAACGGGAAGGGGGCTGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915106271 1:153536737-153536759 ATGGTGAAGAGGGAGGGGGCTGG + Intergenic
915107858 1:153545675-153545697 AAGGAGAAGGGGAGGCTGGTGGG - Intronic
915331700 1:155116736-155116758 ATGGGCGAGGGGAAGGTGACAGG - Intergenic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915515975 1:156412983-156413005 AGGGACTAGGGGGAGGTGGCAGG - Intronic
915523282 1:156460950-156460972 TTGGAAACGGGGAAGGTGGGGGG + Intergenic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916374681 1:164139452-164139474 AAGGAAAAGGGGCAGGTGGCTGG + Intergenic
917367605 1:174249937-174249959 ATGAAGAAGGGCAAGAGGGCCGG - Intronic
917526094 1:175789785-175789807 ATGGTGGAGGGGGAAGTGGCTGG - Intergenic
917730624 1:177871385-177871407 ATAGAGTGGGGGCAGGTGGCAGG + Intergenic
917797387 1:178542108-178542130 GAGGAGAAGGGGAAGGTGTCAGG - Intronic
917846385 1:179024038-179024060 ATGGAGAAGGGAAAACTGGGGGG + Intergenic
918339140 1:183552880-183552902 ATGGAGATGGGGCAGGAGGGTGG - Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919016770 1:192048516-192048538 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
919362005 1:196608426-196608448 TGGGAGAAGGGGAAGGGGACAGG + Exonic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919700776 1:200628980-200629002 GTGGGGAAGAGGAAGGTGACTGG + Intronic
920228526 1:204455310-204455332 AGAGAGAAGGGGAAGGGGGTTGG + Intronic
920298206 1:204972709-204972731 TTGGAGGATGGGAAGGTGGTAGG + Intronic
920330234 1:205202083-205202105 AGGGAGAAGGGGAAGGGAGAGGG + Intronic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920555127 1:206899039-206899061 ATGGAGAAGGAGGAGGTGCAGGG + Intronic
921129715 1:212209300-212209322 ATGGAGGAGGTGGAGGTGCCAGG - Intergenic
921217874 1:212952006-212952028 ATGGGGAAGGGAGAGGTAGCGGG + Intronic
922320264 1:224480713-224480735 ATGGAGATGGGGAACTTGTCGGG - Intronic
922564102 1:226590088-226590110 AATGAGAAGGGGATGGTGGGGGG - Intronic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923072431 1:230577877-230577899 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
923092782 1:230752607-230752629 AGGGAGGATGGGAAGGAGGCGGG + Intronic
923127268 1:231042829-231042851 ATGGTGATGGGTATGGTGGCGGG - Intergenic
923249010 1:232162155-232162177 AGAGAGAGGGGGAAGGTGCCAGG + Intergenic
923334015 1:232951250-232951272 ATGGAGATGGGGATGGGGGTGGG - Intronic
923482446 1:234397454-234397476 ATGGGGGAGGGGAAGGAGGGAGG + Intronic
923785087 1:237058787-237058809 CTGGAGAAGGGGCGGGGGGCCGG + Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062767175 10:74702-74724 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1062987157 10:1779723-1779745 ATAGAGAAGGGCAAGGTCCCTGG + Intergenic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063325671 10:5099330-5099352 ATGGAGAAGTGTAAGGATGCAGG + Exonic
1063335235 10:5206278-5206300 ATGGAGAAGTGTAAGGATGCAGG + Exonic
1063647496 10:7899509-7899531 ATGGAGAAGGGGTGAATGGCTGG - Intronic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1064067722 10:12196672-12196694 ATGGAGATTGGGAAGGTGAAAGG + Intronic
1064360618 10:14661076-14661098 AAGGTGAAGGGGAAGTAGGCAGG - Intronic
1064462834 10:15551461-15551483 ATCAAGAAAGGCAAGGTGGCTGG + Intronic
1064659372 10:17591114-17591136 ATGGAGAAGAGGAGGCTGGGTGG - Intronic
1064818187 10:19291432-19291454 ATTGAGAGGGGAAAGGTGGTTGG + Intronic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1065816808 10:29490141-29490163 AGGGAGCAGGGGGAGCTGGCAGG - Intronic
1065951636 10:30657771-30657793 ATGGAGAAAGGGAGGGAGGGAGG - Intergenic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1066563143 10:36691967-36691989 ATGGAGAAAGGGAAGGGCACGGG - Intergenic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067059462 10:43070528-43070550 AGGGAGGAAAGGAAGGTGGCCGG + Intergenic
1067079373 10:43204656-43204678 ATGGGGAAGGGTGGGGTGGCGGG + Intronic
1067148512 10:43710841-43710863 GTGGACCAGGGGTAGGTGGCAGG + Intergenic
1067216912 10:44310944-44310966 ATGGAGAAGGGGAGGGTGCGCGG + Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1068610183 10:59051126-59051148 ATGGAGTAGGGGGAGGTGGGAGG - Intergenic
1069755977 10:70774653-70774675 AAGGAGAAGGGGGAGGAGGAAGG - Intronic
1069846366 10:71374600-71374622 ATGGAGATGGGGACAGGGGCAGG - Intergenic
1070025231 10:72625942-72625964 AAGGCGAAGGGGAAGGGGGTTGG - Intronic
1070052743 10:72905012-72905034 AGTGAGAAGGGGGAGGTGGCAGG + Intronic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1070299858 10:75195670-75195692 TTGGAGGAGGGGAAGGTAGGAGG - Intergenic
1071356190 10:84798653-84798675 ATTGAGAAAGGGCAGGAGGCAGG - Intergenic
1071481367 10:86067569-86067591 ATAGGCAAGGGGAAGGTGACAGG + Intronic
1071754950 10:88527240-88527262 CTGGGGATGGGGAAGGTTGCTGG - Intronic
1072218154 10:93305382-93305404 ATGGTGGAAGGCAAGGTGGCAGG - Intergenic
1072426418 10:95334441-95334463 ATGGAGAAGGGGCTTGTGCCAGG + Intronic
1072641165 10:97212155-97212177 ATGGTGAAGGGGAAGATGACAGG - Intronic
1072653589 10:97314416-97314438 ATAGAAAAGGGGAAATTGGCTGG - Intergenic
1073046534 10:100642383-100642405 ATGGAGGAGGGGAAGCAGGGAGG + Intergenic
1073243455 10:102073243-102073265 ATGGAGAAGGGAAAGGGCCCTGG + Intergenic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1073420243 10:103418654-103418676 GTGGAGCAGAGGAAGGTGGGGGG + Intronic
1073564392 10:104522655-104522677 ATGGGGCAGGGCAGGGTGGCGGG + Intergenic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1073592141 10:104767654-104767676 GTGGAGAAGGGGAAGGGGAACGG - Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG + Intergenic
1074685861 10:115961987-115962009 AAGGAGAGGGGCAAGGGGGCAGG - Intergenic
1074922023 10:118024434-118024456 ATGGATACGTAGAAGGTGGCGGG - Intronic
1074995442 10:118754236-118754258 ACGGTGAGGGGGAAGGAGGCAGG + Intronic
1075051289 10:119184096-119184118 ATGGGGAAGGGAGAGGTGGGCGG - Intergenic
1075051490 10:119185626-119185648 AAGGTGAAGGGGAAGATGGCAGG + Intergenic
1075219492 10:120572323-120572345 ATGGAGAAGGGGAAGGGCTGTGG - Intronic
1075284506 10:121171845-121171867 AGGGAGAAGGGGAAGGGGAAAGG + Intergenic
1075354717 10:121761071-121761093 AGAGAGGAGAGGAAGGTGGCAGG - Intronic
1075455645 10:122583172-122583194 AGGGAGAAGAGGAAAGTGCCAGG + Intronic
1075457768 10:122595875-122595897 AGGGAGAAGAGGAAAGTGCCAGG + Intronic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1075617697 10:123903546-123903568 CTGGAGATGGCAAAGGTGGCGGG - Intronic
1075634491 10:124021018-124021040 AGGGAGGAGGGGGAGGTGGCAGG + Intronic
1075848353 10:125565445-125565467 TTGGAGAAGGATAACGTGGCAGG + Intergenic
1075918705 10:126191590-126191612 ATGGAGAAGACTAAGGTGGGGGG + Intronic
1076249953 10:128977768-128977790 ATGGAGATGGGGCAGCTGGCTGG + Intergenic
1076257787 10:129042270-129042292 ATGGAGTAGGGAAGGGTGGATGG - Intergenic
1076457033 10:130607547-130607569 AGGGAGCCGGGGAAGTTGGCTGG - Intergenic
1076854221 10:133108040-133108062 GTGGAGAAAGGGAAGAAGGCTGG - Intronic
1077020015 11:413209-413231 ATGGAGAGGGAATAGGTGGCAGG - Intronic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077288703 11:1779033-1779055 ATGGAGAAGGGGATGGAGAGGGG - Intergenic
1077300361 11:1843914-1843936 ATGGAGACGTGGAAGGGGCCGGG + Intergenic
1077658631 11:4046428-4046450 GGTGAGAAGGGAAAGGTGGCAGG - Intronic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1078484021 11:11705385-11705407 AGGGAGAAAGGGAAGGAGGGAGG + Intergenic
1078862446 11:15262151-15262173 TTGCAGAAGGGCAAGGTGCCTGG + Intergenic
1079206155 11:18416723-18416745 ACGGAGAAGGGAAAGGGGGAAGG - Intronic
1079214743 11:18498552-18498574 ATGGAGATGGGGCAGGTGTTAGG + Intronic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1079641902 11:22816171-22816193 ATGGGGGAGGGGGAGGTGGGCGG - Intronic
1079718650 11:23782989-23783011 AAGGTGAAGGGGAAGCTGGCAGG + Intergenic
1080031990 11:27671156-27671178 ATGGAGTAGGGGTAGGGGGGAGG + Intronic
1080562182 11:33474046-33474068 AGAGAGAGGGAGAAGGTGGCAGG + Intergenic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1080760088 11:35240323-35240345 AAGGAGAAAGGGAAGGTTGTGGG + Intergenic
1080846843 11:36034273-36034295 TTGGAGAGGGGCAAGCTGGCAGG + Intronic
1081155472 11:39684415-39684437 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1081207527 11:40293099-40293121 AGGGGAGAGGGGAAGGTGGCTGG - Exonic
1081562044 11:44226676-44226698 ATGGGAAAGGGGCAGCTGGCTGG - Intronic
1081586634 11:44389488-44389510 AAGGAAAAGGGGAAGATGCCAGG - Intergenic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1082033289 11:47623072-47623094 AAAGAGCAGGGAAAGGTGGCCGG + Intronic
1082196797 11:49316251-49316273 AAGGAGAAGGGGAAGGGGTAAGG + Intergenic
1082244439 11:49905202-49905224 AGGGGGAAGGGGAAGGAGGGGGG + Intergenic
1082735887 11:56855063-56855085 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1082943663 11:58735337-58735359 ATAGAGACGGGGGAGGTGCCAGG - Intergenic
1083429660 11:62607636-62607658 ATGGATAAGTGGAAGGTGATGGG - Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083680203 11:64348287-64348309 TTGGAGCAGGAGAAGGTGGCTGG + Intronic
1083738010 11:64692741-64692763 GTGGAGGAGGGGAAGGGGACAGG + Intronic
1083777047 11:64899198-64899220 ATAGAGAAGGGGTAGGGGCCGGG - Intronic
1083883388 11:65558988-65559010 AAGGAAAGGGGGGAGGTGGCAGG - Intergenic
1084148060 11:67275471-67275493 AGGAAGAAGGGGAAGGGGGTGGG - Intronic
1084188714 11:67489177-67489199 ATGGTGGTGGGGAAGGGGGCTGG + Intronic
1084287866 11:68143289-68143311 ATGGAGTCTGGGGAGGTGGCAGG + Intergenic
1084403167 11:68956437-68956459 ATAGAGGAGGGGAAGGTGGGGGG - Intergenic
1084408267 11:68991465-68991487 TGGGGGATGGGGAAGGTGGCAGG - Intergenic
1084443332 11:69188671-69188693 ATGGAGAAGGGGCACGAGCCAGG + Intergenic
1084524942 11:69690918-69690940 AGGGAGGAAGGGAAGGTGGGAGG + Intergenic
1084678116 11:70648746-70648768 ATGGAGAGGGGGAAGGGGTTTGG + Intronic
1084735686 11:71103845-71103867 AGGGAGAAGGGGAGGGGGGGAGG - Intronic
1085204156 11:74720523-74720545 AGGGAGTCGGGGATGGTGGCTGG - Intronic
1085309320 11:75506910-75506932 ACAGAGAAGGGGAGGGGGGCAGG - Intronic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086659027 11:89391934-89391956 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087044807 11:93836072-93836094 ATGAGGAAGGAGAAGGTGTCAGG - Intronic
1087242035 11:95790566-95790588 ATGGAAAAGGGCAAGGGTGCTGG - Exonic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088398302 11:109393293-109393315 AGGGAGAAATGGAAAGTGGCTGG + Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089074173 11:115724774-115724796 ATGGCCAAGGGGAAGATGGGAGG - Intergenic
1089196263 11:116695605-116695627 AGGGAGGAGGGGAAGAGGGCAGG - Intergenic
1089255657 11:117192654-117192676 ATGGAGCAGGGGAACCAGGCAGG - Intronic
1089418661 11:118314696-118314718 ATGGAGAGGTGGAAGCTTGCAGG + Intronic
1089460879 11:118652771-118652793 AGGGAGAAGGGGCAGGAGACAGG + Intronic
1089468246 11:118700067-118700089 ATCAAGAAGTGGAATGTGGCCGG + Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089603647 11:119629286-119629308 AGGCAGAAGGGACAGGTGGCAGG + Intronic
1089608598 11:119656749-119656771 AGGCGGAAGGGGAGGGTGGCAGG - Intronic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1089710120 11:120308487-120308509 TAGGAGTAGGGGAAAGTGGCCGG + Intronic
1089786129 11:120908588-120908610 GAGGGAAAGGGGAAGGTGGCAGG + Intronic
1090060790 11:123462553-123462575 TTGGAGAAGGGGTGGGTGGCAGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090960309 11:131550549-131550571 AAGGCGAAGGGGAAGAAGGCAGG - Intronic
1091124400 11:133082505-133082527 GGGGAGGAGGGGAGGGTGGCAGG - Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1092205704 12:6613294-6613316 AGGGAGAAGGGGAAGGACGGTGG + Intergenic
1092334292 12:7614991-7615013 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1092739841 12:11616859-11616881 AAGGTGAAGGGGAAGCAGGCAGG + Intergenic
1092914074 12:13173733-13173755 ATGCGGAAGGGGAAGGAGCCAGG + Intergenic
1093396523 12:18690059-18690081 ATTGAGAAAGTGAAGGTGGAAGG - Intronic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1094282130 12:28752135-28752157 GTGGAGTAGGGGGAGGTGGGAGG - Intergenic
1094319573 12:29170843-29170865 ATCGAAAAGGGGAAGGTGAGGGG - Intronic
1094382308 12:29856099-29856121 ATGGAGAGGGCGAAGGGGGGCGG + Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095886427 12:47193404-47193426 GTGGAAAGGGGGAAGGGGGCAGG - Intronic
1095952994 12:47791585-47791607 CTGGACAACGGGAAGCTGGCAGG - Exonic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096001048 12:48130956-48130978 AAGGAGAAGGGGAAGTTGGTGGG - Intronic
1096152535 12:49323576-49323598 ATTGAGACGGGGAAGAAGGCAGG - Intronic
1096476885 12:51913914-51913936 ATAGAGAAGGGGGCTGTGGCTGG + Intronic
1096498926 12:52053978-52054000 ATGGGGGAGGGGCAGGGGGCTGG + Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096750262 12:53754117-53754139 ATGGATAATGGGAAGATGGAAGG + Intergenic
1097102207 12:56597777-56597799 AAGGAGGTGGGGAAGGAGGCTGG + Exonic
1097176951 12:57148838-57148860 ATGGGGAAGAAGGAGGTGGCTGG + Intronic
1097738633 12:63212130-63212152 AAGGAGAAGGGGATGGAAGCAGG - Intergenic
1097908811 12:64947685-64947707 ATGGAGAAGGGAAAGGCTGAAGG - Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099091392 12:78314552-78314574 AGAGAGAGGGGGAAGGTGGCAGG + Intergenic
1099659979 12:85545148-85545170 AAGGAGGAGGAGAAGGTAGCAGG - Intergenic
1100379549 12:94048869-94048891 ATGGAGCAGAGGAAGGTGAGAGG - Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1101746718 12:107547210-107547232 AAGGAGAAGGGGGAGGGGGAGGG + Intronic
1102012828 12:109629323-109629345 AAGGAAAGGGGGAAGGTGGGAGG - Intergenic
1102166744 12:110812994-110813016 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102625633 12:114233259-114233281 AGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102992049 12:117322504-117322526 AAGGAGGAGGGGAAGGAGGGAGG - Intronic
1103004350 12:117409356-117409378 ATGGAGGGGTGGAAGGTGGATGG + Intronic
1103164099 12:118755418-118755440 AGAGAGAAAGGGAAGGTGCCAGG + Intergenic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103359501 12:120345572-120345594 CTGAAGCAGGGGACGGTGGCAGG - Exonic
1103371572 12:120423323-120423345 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103454642 12:121055396-121055418 ATGGAGGAGGGGAGGGAGGTGGG - Intergenic
1103477933 12:121232376-121232398 ATGGATCAGGGGGAGATGGCTGG - Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1104136372 12:125943220-125943242 ATGGAGCTGGGGGTGGTGGCTGG - Intergenic
1104768539 12:131345965-131345987 GAGAAGAAGGGCAAGGTGGCAGG + Intergenic
1104863302 12:131936810-131936832 ATACAGAAGACGAAGGTGGCAGG + Intronic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105059432 12:133134980-133135002 ATGGAGAAAGGAAATGTGGCTGG - Intronic
1105564385 13:21529894-21529916 ATGGAGAAGGGGAAGGATCAGGG + Intronic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106086873 13:26550731-26550753 GTGGGGAAGGGGAGGGTGCCTGG - Intergenic
1106771511 13:32965278-32965300 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1106790541 13:33151405-33151427 ATAGAAAAGGGGAAGGTTCCAGG + Intronic
1106927277 13:34626192-34626214 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1107036121 13:35904568-35904590 AGGGAGATGGGGAAAGTGGTGGG + Intronic
1107062930 13:36180275-36180297 GTGGTGAAGGGGGAGGAGGCTGG - Intronic
1107170393 13:37334745-37334767 ATGGAGGAAGGGATGGTGACCGG - Intergenic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1107320095 13:39177428-39177450 AGGGAGTAGGGGAAGAAGGCCGG + Intergenic
1107795451 13:44046897-44046919 AAGGAGAAGGGGAAGGGGAAAGG - Intergenic
1107795460 13:44046921-44046943 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1107802108 13:44118283-44118305 GCAGAGAAGGGGAAGGTGCCTGG - Intergenic
1108156596 13:47591545-47591567 ATGGGGTGGGGGAAGGGGGCAGG + Intergenic
1108577444 13:51802456-51802478 ATGGGGAGGAGGAAGCTGGCAGG + Intronic
1108703863 13:52967575-52967597 ATGGAGGAGGGGAGGGTGATAGG - Intergenic
1109142023 13:58725296-58725318 ATGGAGAAGGAGCTGGTGGCAGG + Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1110014784 13:70386862-70386884 CTGGAGGGGGGCAAGGTGGCAGG + Intergenic
1110184507 13:72657162-72657184 ATGCAGAAGGGGAACCTGGGGGG + Intergenic
1110646849 13:77896202-77896224 ATGGAGAAGGAAAAGGTATCAGG + Exonic
1110932779 13:81243457-81243479 ATAGGGAAGGGGAAAGTGGTAGG - Intergenic
1112282651 13:98076375-98076397 GTGGAGCAGGGGATGGTGCCTGG + Intergenic
1112520570 13:100091105-100091127 ATGGTGTTGGGGAAGCTGGCAGG + Intronic
1112571192 13:100595086-100595108 ATGGAGAAGGGGCAGGCTGTAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113398242 13:109968627-109968649 GTGGAGAAGGGAGACGTGGCTGG + Intergenic
1113587788 13:111477055-111477077 GAGGCGAAGGGGAAGCTGGCAGG - Intergenic
1113740087 13:112705578-112705600 ATGGAGGACGGGAAGCCGGCAGG + Intronic
1113923422 13:113927390-113927412 GTGGAGAGGGGGGAGGTGTCTGG - Intergenic
1114179177 14:20350929-20350951 AGGGAGAAGGGAAAGGTGAAAGG - Intronic
1114460358 14:22882694-22882716 GTGGAGAAGGAAAAGGTGGCAGG + Intergenic
1114525392 14:23364777-23364799 AAGGAGAATGGGGAGGGGGCGGG + Intronic
1115111457 14:29828325-29828347 AGAGAGAAGGAGAAGGTGCCAGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115501656 14:34055093-34055115 ATGGAGAAGTGGAAGGGGTGTGG + Intronic
1115529359 14:34312796-34312818 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1116383024 14:44296157-44296179 TGGGAGAAGGTGAAGGTGGGTGG + Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1116794171 14:49372466-49372488 AAGGAGAAAGGGATAGTGGCAGG - Intergenic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1117642014 14:57810131-57810153 ATGGAGGAGGGGCATGTGACAGG - Intronic
1118171909 14:63396084-63396106 GAGGAGAAGGGGGAGGGGGCAGG + Intronic
1118392458 14:65306819-65306841 AGAGAGAGGGGGAAGGTGCCAGG - Intergenic
1118513822 14:66505857-66505879 ATGGAGATGGGGAGGGTTGATGG - Intergenic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118744358 14:68763138-68763160 AAGGAGAAGGGGGAGGAGTCTGG - Intergenic
1119140547 14:72263456-72263478 ATAGAGAAGGGGGAGGTTGGAGG - Intronic
1119201478 14:72756027-72756049 ATGGAGGTGGGGAAGGAGGATGG + Intronic
1119906115 14:78303629-78303651 TTGGAGATGGGGGAGCTGGCAGG - Intronic
1119977124 14:79037602-79037624 AAGGAGGAAGGGAAGGTGTCAGG - Intronic
1120059085 14:79960519-79960541 ATGGAGCAGGGGGAGGAGACAGG + Intergenic
1120281453 14:82443663-82443685 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121019793 14:90572972-90572994 AAGGAGAAGGGGAAAGTGATGGG - Intronic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121410580 14:93745991-93746013 AGGGAGAAGGGGAAGGATGGGGG - Intronic
1121445787 14:93977991-93978013 ATTGGGAAGGGGCAGGTGGTGGG - Intergenic
1121535496 14:94687800-94687822 AAAAAGAGGGGGAAGGTGGCAGG - Intergenic
1121577518 14:95000458-95000480 AAGGCGAAGGGGAAGCAGGCAGG + Intergenic
1121593385 14:95137555-95137577 ATGGAGAAGGGGAAGGGAAAGGG + Intronic
1121714738 14:96065566-96065588 AGAGAGAAGGGGAAAGTGGTGGG - Intronic
1122048250 14:99038500-99038522 ATAGTTAAGGGGAGGGTGGCTGG - Intergenic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1122242646 14:100379044-100379066 AGGGTGCAGGGGAAAGTGGCAGG + Intronic
1122555125 14:102574787-102574809 ATGGAACTGGGGAAGGTGACGGG - Intergenic
1122593348 14:102871229-102871251 ATGGAGAAGGGGGAGGGTGAAGG - Intronic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1124134469 15:27022046-27022068 ATCTACCAGGGGAAGGTGGCAGG - Intronic
1124227908 15:27911595-27911617 AGAGAGAAGGGGGAGGTGCCAGG + Intronic
1124793687 15:32754443-32754465 AGGGAGAAGGGGAAGGTGCCAGG - Intergenic
1124844694 15:33279100-33279122 ATGGAGCAGGGGGAGCTGACGGG + Intergenic
1126210607 15:46097478-46097500 TTGGAGAAGGGGGATTTGGCAGG + Intergenic
1126216886 15:46165710-46165732 ATGGACAAAGGGAAGATGGATGG + Intergenic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127507474 15:59610622-59610644 ATGGAGAGAGGGAAGGAGGGAGG - Intronic
1127691117 15:61398660-61398682 AGGGAGAGGGGAAAGGTGGAGGG + Intergenic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1127833417 15:62770587-62770609 GTGGAAAAGGGTAAGGTAGCAGG - Intronic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128156888 15:65396761-65396783 ATAGAGCAGGGGGAGGTGGACGG - Intronic
1128220877 15:65967720-65967742 AAGGAGAAGAGGACGGTGACTGG + Intronic
1128331078 15:66756101-66756123 AGGGAGAAGGGGGAGGTGTGGGG - Intronic
1128568240 15:68715177-68715199 ATGGAGTTGAGGAAGGTGGCAGG - Intronic
1128990677 15:72257323-72257345 ATGGGGGAGGGAAACGTGGCTGG - Intronic
1129039098 15:72670476-72670498 ATGGGGCAGAGGAAGGAGGCGGG + Intergenic
1129138182 15:73573016-73573038 AAGGTGAAGGGGAAGCAGGCAGG - Intronic
1129145885 15:73646811-73646833 ATGGAGGAGGGGGAGGGGGAGGG + Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129198913 15:73986995-73987017 AGGCAGAAGGGCAAGGAGGCAGG + Intronic
1129230410 15:74194084-74194106 CTCGAGAAGGGGAAGTGGGCAGG - Intronic
1129399610 15:75274326-75274348 ATGGGGCAGAGGAAGGAGGCGGG + Intronic
1129698535 15:77754396-77754418 ATTCAGAAGCGGACGGTGGCTGG - Intronic
1129741640 15:77992384-77992406 CTGGAGCAGGGGGAGGTGGCGGG + Intronic
1130517819 15:84639698-84639720 CTGGAGGATGAGAAGGTGGCAGG + Exonic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1130661368 15:85833756-85833778 ATGGGGAAGGGGCAGGTGGGCGG + Intergenic
1130792870 15:87174583-87174605 AGAGAGAAGGGGAAGATGCCAGG - Intergenic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1131059782 15:89397562-89397584 AGGGAGCAGGGGCAGGGGGCAGG + Intergenic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1132240028 15:100250538-100250560 TTAGGGAAGGGGAGGGTGGCAGG + Intronic
1132533661 16:466742-466764 AGAGAGAAGGGGACGGTGTCTGG - Intronic
1132611229 16:817248-817270 AGCGAGAAGGGGAGGGTGGCTGG + Intergenic
1132815196 16:1822493-1822515 CTGGAGCAGGGCAAGCTGGCAGG - Intronic
1132872284 16:2121068-2121090 AAGGAGAAGGGGAAAGAGCCGGG + Intronic
1132973428 16:2700127-2700149 AGGGAGGAGGGGAAGGTGCGGGG - Intronic
1133066411 16:3210528-3210550 AGGGAGAAGGGGAAGCTCCCAGG - Intergenic
1133221792 16:4322051-4322073 GGGCAGAAGGGGATGGTGGCTGG + Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133612601 16:7447551-7447573 ATGGATAATGAGAAGGTGACTGG - Intronic
1133725641 16:8534957-8534979 ATGGAGAAGGGGATGATGACAGG - Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133816313 16:9200010-9200032 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1133839407 16:9394452-9394474 AGGGAGGAAGGGAAGGAGGCAGG - Intergenic
1134039488 16:11057480-11057502 AATGAGCAGGGGAAGGTGGGTGG - Intronic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134352619 16:13451929-13451951 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1134551333 16:15140147-15140169 AAGGAGAAGGGGAAAGAGCCGGG + Intergenic
1134822332 16:17256951-17256973 ATGGAGATTGGGGAGGTGTCAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135506301 16:23039775-23039797 AAGTAGAAGGGGCAGGTGGCAGG + Intergenic
1135737134 16:24940735-24940757 TTGGGGAAGGGAATGGTGGCTGG + Intronic
1135771932 16:25224419-25224441 CAGGAGCAGGGGCAGGTGGCAGG + Exonic
1136361895 16:29785905-29785927 ATGGAGAAGAGAATGGGGGCTGG - Intergenic
1136381330 16:29897249-29897271 GTGGGGAAGGGAAAGGTGGGGGG - Intronic
1136427457 16:30178594-30178616 ATGGAGAAGGCGGAGGGGGTAGG + Intergenic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1136698950 16:32115558-32115580 ATGGAGATGGGGTAGAAGGCCGG - Intergenic
1136768658 16:32812270-32812292 ATGGAGATGGGGTAGAAGGCTGG + Intergenic
1136799457 16:33058858-33058880 ATGGAGATGGGGTAGAAGGCCGG - Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137549189 16:49425266-49425288 GTGGGGAAGGGGACAGTGGCTGG - Intergenic
1137554196 16:49460475-49460497 ATGGAGAAGGGGAGGTTTGAGGG + Intergenic
1137738685 16:50743091-50743113 ATTGAGGAGAAGAAGGTGGCAGG - Intronic
1138513921 16:57525556-57525578 ATGGAGACAGGGAAGTTGGAAGG - Intronic
1138550479 16:57745101-57745123 ATGGAGAATGGGAAGGAGTGGGG - Intronic
1138579411 16:57930558-57930580 AAGGAGGAGGGGAAGGGGGAGGG + Intronic
1138600548 16:58051554-58051576 AGGGAGGAAGGGAAGGTGGGAGG + Intergenic
1139060940 16:63250684-63250706 AAGAAGAAGGGGAAGGCGGAGGG + Intergenic
1139066777 16:63325404-63325426 GAGGAGGAGGGGAAGTTGGCAGG + Intergenic
1139290703 16:65855580-65855602 GTGGAGCAGGGCCAGGTGGCAGG + Intergenic
1139391581 16:66609103-66609125 ATGGAGAGCGGGAAGGGAGCAGG + Intronic
1139895976 16:70288403-70288425 ATCAAGAAGGGGAAGGCGGCCGG - Intronic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1140178492 16:72689746-72689768 ATGGAGAAAGGGAAGGAAGGAGG - Intergenic
1140217439 16:73019774-73019796 ATAGAGAAAGGGAAGGGGGCGGG - Intronic
1140674657 16:77316128-77316150 ATGGTGACTGTGAAGGTGGCAGG - Intronic
1141173231 16:81704209-81704231 AGGGAGGAGGGGGAGGGGGCAGG - Intronic
1141173314 16:81704414-81704436 AGGGAGGAGGGGGAGGGGGCAGG - Intronic
1141483070 16:84319604-84319626 AGGGAGAAGGGGACTGGGGCAGG - Intronic
1141585061 16:85028090-85028112 AGGGAATAGGGGAAGGTCGCCGG + Intronic
1141792753 16:86247979-86248001 ATGGAGATGGGAAAGGAGCCGGG + Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141896052 16:86959365-86959387 AAGGGGAAGGGGAAGATGGATGG + Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142112412 16:88339588-88339610 AGGGGGATGGGGATGGTGGCAGG + Intergenic
1203071075 16_KI270728v1_random:1074378-1074400 ATGGAGATGGGGTAGAAGGCCGG + Intergenic
1142983093 17:3682542-3682564 CTGGAGAAGGGGATGGGGACTGG + Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143459265 17:7090393-7090415 ATTGAGAAGGCTAAGGTGGGAGG + Intergenic
1143514953 17:7414887-7414909 AAGGAGAGGGGGGAGTTGGCAGG - Intronic
1143632293 17:8146209-8146231 AAGGGGAAGGGGATGGTGGTAGG + Intronic
1143662895 17:8338026-8338048 ATGGAGCAGGGGGAGGGAGCAGG - Intergenic
1143725451 17:8842019-8842041 AGAGAGAGGGGGAAGGTGCCGGG - Intronic
1143743061 17:8967781-8967803 ATGGAGAATGGATAGGTGTCAGG - Intergenic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1144389802 17:14783426-14783448 ATGGAGCAGGAGAAGGTCACAGG + Intergenic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144538939 17:16120038-16120060 ATTGAGAAAGGGAATATGGCAGG - Intronic
1144576277 17:16431864-16431886 GTGGGGAAGGGGGAGGGGGCCGG - Intronic
1144766849 17:17737794-17737816 CTGGAGTAGGCGGAGGTGGCTGG - Intronic
1144816207 17:18037270-18037292 ATAGAAATGGGGAAGGGGGCTGG - Intronic
1144844649 17:18210284-18210306 CTGGTGAAGGGGGAGATGGCAGG + Intergenic
1145809518 17:27756128-27756150 TGCTAGAAGGGGAAGGTGGCGGG + Intergenic
1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG + Intronic
1146722381 17:35132452-35132474 GTGGAGAAGGGAAGGGTGTCAGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147003130 17:37379389-37379411 TTGGAAAAGAGGAAGGGGGCAGG + Intronic
1147327453 17:39676304-39676326 AAGGAGAAGAGGAAGGCGGCAGG + Intronic
1147363592 17:39946154-39946176 AGGGGCAAGGGGAAGGTGGGTGG + Intergenic
1147384970 17:40075660-40075682 ATGGGGGAGGGGAAGGTGATGGG - Intronic
1147473764 17:40689789-40689811 GTGGAGTGGGGGAAGGTGGGAGG - Intergenic
1147722970 17:42550072-42550094 ATGCAGCAGAGGAAGGGGGCAGG + Exonic
1147724182 17:42556299-42556321 ATGCAGCAGAGGAAGGGGGCAGG + Intergenic
1147754677 17:42760824-42760846 GTGGAGAAGAGGGAGGGGGCTGG - Intronic
1147924693 17:43939091-43939113 GTGGAGTGGGGGAAGGTGGATGG - Intergenic
1147976894 17:44253048-44253070 AAGGGGAAGGGGAAGGGGCCGGG + Intronic
1148052372 17:44775551-44775573 CGGGAGGAGGGGAAGGAGGCGGG - Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148757164 17:49979485-49979507 AGAGAGAAAGGGAAGGTGGCAGG - Intergenic
1148844203 17:50519131-50519153 ATGGAGGAGGGGGCGGGGGCAGG + Intronic
1149433015 17:56609561-56609583 ATGGAAAAGGCCAAGGTGGGTGG - Intergenic
1149717288 17:58804505-58804527 ATGGAGATAGGGAAGGGGGATGG + Intronic
1150128532 17:62653757-62653779 TGTGAAAAGGGGAAGGTGGCCGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151350650 17:73530007-73530029 ATGGACATGGGCAAGGTGGAAGG + Intronic
1151408236 17:73903108-73903130 AGGGAGGAGTGGAAGGGGGCGGG + Intergenic
1151430497 17:74059325-74059347 ATAAAGAAAGGGAAGGGGGCTGG + Intergenic
1151470003 17:74312066-74312088 AAGGAGAAGGGTAAGGCGGAGGG + Exonic
1151669513 17:75564345-75564367 ATGGTGAAGGGCAACCTGGCAGG - Exonic
1151727757 17:75894490-75894512 AGGGAGATGGGGAAGGTCGGGGG - Intronic
1152107231 17:78337756-78337778 AAGGAGAAGGGGAAGGTGACTGG - Intergenic
1152179010 17:78806229-78806251 ATGGTGAGGGGGGAGGTGGACGG + Exonic
1152202361 17:78954506-78954528 GTTGAGAAGGGGACGGGGGCAGG + Intergenic
1152264469 17:79286390-79286412 ATGGAGGAGGGGATGGGGACAGG - Intronic
1152308250 17:79533620-79533642 ATGGGGAAGGGGAAGCTCTCAGG + Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1153537049 18:6113684-6113706 GTGGAGTAGAGGAAGGTAGCAGG - Intronic
1153544013 18:6186999-6187021 ATGGAGACGGGGCAGGTGGAGGG + Intronic
1153578654 18:6549406-6549428 AGAGAGAAGGGGAAGGTCCCAGG + Intronic
1153986750 18:10357553-10357575 ATGGTGAAGGGGAAGGAAGCAGG - Intergenic
1154111936 18:11577692-11577714 AAGGGGAAGGGGAAGGTGGGAGG + Intergenic
1154322901 18:13368879-13368901 AGGGCCATGGGGAAGGTGGCAGG + Intronic
1155226958 18:23737386-23737408 ATGGGGTGAGGGAAGGTGGCTGG - Intronic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1155871195 18:31030701-31030723 AGGGAGAGAGGGAAGGTGACAGG + Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156490334 18:37492196-37492218 GTGGGGAATGGGAAGGTAGCAGG + Intronic
1156706444 18:39888782-39888804 AAGGAGAAGGGGAAGGAGAGGGG - Intergenic
1156841909 18:41618964-41618986 TTGGAGAAGGGGATGGGGGCTGG - Intergenic
1156980199 18:43277571-43277593 AGGGAGGAGGGGAGGGGGGCAGG - Exonic
1157187389 18:45552326-45552348 AAGGAGAAGGGGAATGCAGCTGG + Intronic
1157191471 18:45585769-45585791 ATGCAGAGGGAGAAGGGGGCAGG - Intronic
1157327346 18:46678668-46678690 AAGGAGAAAGGGGAGGAGGCAGG + Intronic
1157436337 18:47672631-47672653 ATGGAGATGGGGACGGGGGGCGG + Intergenic
1157476278 18:48025506-48025528 ATGGAGAAGGGGAAGGGAACTGG - Intergenic
1157522011 18:48351982-48352004 ATGGAGGTGAGGAAGGGGGCTGG - Intronic
1157522602 18:48355743-48355765 ATTGAGAAGAGGAAGGTTGCAGG - Intronic
1157941568 18:51934438-51934460 ATGGATAAGAGGGAGGTGGGAGG + Intergenic
1158140028 18:54245723-54245745 CTGGAGAAGGGGTTGGAGGCAGG - Intergenic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158736695 18:60090679-60090701 TTGGAGAAGGGGGATGTGGTTGG + Intergenic
1158855855 18:61542827-61542849 AGGCAGGAGGGGAAGGTGCCAGG + Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159420330 18:68210605-68210627 GAGGTGAAGGGGAAAGTGGCAGG + Intergenic
1159902798 18:74063791-74063813 TTGAAGAAGCGGAAGGTGACAGG - Intergenic
1160123631 18:76151451-76151473 ATGGGGAAAGGGAAGGTGTGAGG - Intergenic
1160251850 18:77210150-77210172 AAGGATAAGGGGTAGGGGGCAGG - Intergenic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1160380691 18:78452925-78452947 ATACAGAAGGGTAAGGTGGCTGG + Intergenic
1160752347 19:740375-740397 GTGGAGAAGGACAAGGTGACAGG + Exonic
1160809426 19:1007061-1007083 ATGTTGATGGGGAAGGAGGCTGG + Intronic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1161988360 19:7669964-7669986 CTGGACACGGGGAACGTGGCGGG - Intronic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1163320759 19:16573149-16573171 CTGCAGAAGGGGGAGGTGCCGGG + Intronic
1163353738 19:16796094-16796116 ATGGGGGAGGGGCAGGTGGTAGG + Intronic
1163505220 19:17701755-17701777 ATGGAGAAGGGGCAGATCTCAGG + Intergenic
1164217131 19:23160656-23160678 ATGGAGAAGGGGGAAGTGTGGGG - Intergenic
1164563961 19:29312616-29312638 GTGGAGCAGGGGGAGGTGGGAGG + Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1165144801 19:33724313-33724335 GTGCAGAAGGGGAAGGTGCTGGG + Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166062429 19:40334987-40335009 AGGGAGAAAGGGAAGGAGGGAGG + Intronic
1166674944 19:44734651-44734673 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1166933616 19:46317471-46317493 AGTGAGAAGGGGAGGGAGGCAGG - Intronic
1167033324 19:46978085-46978107 AAGTATAAGGGGAGGGTGGCAGG + Intronic
1167154559 19:47730192-47730214 AGGAAGCAGGGGAAGGTGCCAGG - Intronic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1167240792 19:48342080-48342102 AGGGAGAAAGGGAAGGGGGGAGG + Intronic
1167264916 19:48478652-48478674 ATGGAGGAGGGGCAGGGGCCTGG + Intronic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1167347470 19:48955362-48955384 ATGGAGAAAGGCCAGGAGGCTGG - Intronic
1167462495 19:49633228-49633250 ATCGAGAAGGGACAGGTGGGTGG - Intergenic
1167509549 19:49888800-49888822 GTTGAGGAGGGGATGGTGGCTGG + Intergenic
1167674410 19:50875500-50875522 AGAAAGGAGGGGAAGGTGGCCGG + Intronic
1167702104 19:51054950-51054972 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1167758901 19:51431028-51431050 AAGGTGAAGGGGAAGCAGGCAGG - Intergenic
1168078257 19:53992035-53992057 CTGGAAAAGGGGCCGGTGGCCGG - Intergenic
1168133447 19:54336000-54336022 ATGGACAAGGGGAAGATGCTGGG - Intronic
1168243801 19:55099990-55100012 AAGGTGAAGGGCAAGGTGGGCGG - Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
1168532093 19:57138093-57138115 AGGGAGGAAGGGAAGGAGGCAGG + Intronic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
925064590 2:920521-920543 AAGGAGGAGGGACAGGTGGCAGG - Intergenic
925085053 2:1101230-1101252 ATGGAGACAGGCAAGCTGGCTGG - Intronic
925264606 2:2558191-2558213 ATGGAGAGAGGAAATGTGGCTGG + Intergenic
925361698 2:3284478-3284500 ATGGAGATGGGGCGGGAGGCCGG + Intronic
925420525 2:3706969-3706991 ATGCAGTAGGGTAAGGTGCCTGG + Intronic
925709914 2:6728842-6728864 AAGGTGAAGGGGAAGCAGGCAGG + Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926330088 2:11817250-11817272 ATGAAGGAGGGGAAGGTAGTGGG + Intronic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
927255776 2:21039797-21039819 AGGGAGAGGGGTATGGTGGCAGG - Intronic
927278440 2:21281822-21281844 GTGGAGAAAGGGAAGGTTGGAGG + Intergenic
927287480 2:21371607-21371629 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
927576854 2:24207749-24207771 AGTGAGAAGGGGGAGGAGGCAGG + Intronic
927717248 2:25360759-25360781 CTTGAGAAAGGAAAGGTGGCGGG - Intergenic
927866174 2:26589147-26589169 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
927932334 2:27053050-27053072 ATGGGGAAGGGGTAGGAGGTGGG + Exonic
927937749 2:27085091-27085113 ATCCAGCAGGGGAAGGGGGCTGG + Intronic
928122384 2:28592363-28592385 AGGAAGAAGGGAAAGGTGGGAGG - Intronic
928123685 2:28602004-28602026 ATGGTGAGGGTGAAGGTGGATGG + Intronic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
928432166 2:31229189-31229211 AAGGAGAAGGGGCAGGAGACAGG + Intronic
928902798 2:36338673-36338695 AGAGAGAAGGGGAGGGTGGCAGG - Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929002902 2:37365778-37365800 ATGAAGATGGGTGAGGTGGCAGG + Intronic
929250079 2:39743641-39743663 AGGGAGAAGGGGGAGGTGCCAGG - Intronic
929444482 2:41991902-41991924 AGGGAGAAGGGGAAGGGGAGGGG + Intergenic
929487345 2:42366805-42366827 AGAGAGAAAGGGAAGGGGGCTGG - Intronic
929490518 2:42392190-42392212 ATGCATTAGAGGAAGGTGGCAGG - Intronic
929981689 2:46687276-46687298 ATGGAAAAGGTGAATTTGGCTGG + Intergenic
930392385 2:50778547-50778569 ATGAACAAAAGGAAGGTGGCAGG + Intronic
930826374 2:55700413-55700435 AGGAAGAAAGGGAAGGTGGGAGG - Intergenic
931220480 2:60284399-60284421 ATGGGGAAGGGGAGTGGGGCTGG - Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
933190393 2:79327795-79327817 ATGCAGAAGGGGCAGGGGGATGG + Intronic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933475625 2:82786453-82786475 ATGGAGAAAGAGAAGGGGGGCGG + Intergenic
933787419 2:85854485-85854507 AGGGAGAAGGGGCAGGGAGCGGG + Intronic
933937207 2:87216466-87216488 TTGGAGAAGGGGTTGGTAGCAGG + Intergenic
933938485 2:87226078-87226100 GAAGAGAAGGGGAAGGGGGCTGG - Intergenic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
935141390 2:100355960-100355982 ATGGGGAGGGGGAAGGGGACAGG - Intergenic
935353919 2:102180405-102180427 GGGGAGAAGGGGCAGGTGGCAGG + Intergenic
935651645 2:105387183-105387205 AGGGAGAAGGGGAAGATGCAAGG - Intronic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936355936 2:111749358-111749380 TTGGAGAAGGGGTTGGTAGCAGG - Intergenic
937039223 2:118808011-118808033 AGGGAGAGGGGGGAGGTGGCAGG + Intergenic
937130902 2:119512328-119512350 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
937282022 2:120724398-120724420 AGAGAGATGGGGAAGGTGCCAGG + Intergenic
937299544 2:120830672-120830694 CTGGAGAATGTGCAGGTGGCTGG + Intronic
937379307 2:121362293-121362315 ACAGAGAATGGGGAGGTGGCAGG - Intronic
937484311 2:122298014-122298036 ATGGGGTCGGGGGAGGTGGCTGG + Intergenic
937492401 2:122383578-122383600 ATGGAGTAGGGGACGGGGGGAGG - Intergenic
937912100 2:127080768-127080790 AGGGAGGGGGGGCAGGTGGCAGG + Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
938043410 2:128095377-128095399 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
938074893 2:128326535-128326557 CTGCAGAAGAGGGAGGTGGCAGG + Intergenic
938315843 2:130327534-130327556 ATGCAGTAAGGGAAGGAGGCAGG + Intergenic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
939481528 2:142753989-142754011 ATGGAGAAGGGAAAGGTGTGAGG + Intergenic
940306494 2:152232691-152232713 GTGGAGATGGGGAAAGTGGATGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941038253 2:160590654-160590676 AGGGAGGAGGGGAAGGGGGAGGG - Intergenic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
941234027 2:162946635-162946657 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
941846918 2:170142488-170142510 TTGGAGACCGGGAAGGAGGCAGG - Intergenic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942108595 2:172658002-172658024 AGAGAGAAGGGGAAAGTGCCTGG + Intergenic
943152084 2:184126469-184126491 AATGAGAAAGGGAAGGTGCCAGG + Intergenic
943340141 2:186671090-186671112 ATCGAGAAGGGAAAGGAGCCTGG - Intronic
943725376 2:191246240-191246262 AGAGGGAAGGGGAAGGGGGCGGG + Intronic
943732303 2:191315207-191315229 AGGGAGGAGGGGAAGATGGATGG - Intronic
943746049 2:191463711-191463733 ATGTAGAAGGGGTAGCTGGATGG - Intergenic
943921535 2:193713263-193713285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
944580186 2:201125579-201125601 GTGGAAAGGTGGAAGGTGGCAGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946177334 2:217929650-217929672 GTGGAGATGGGGGTGGTGGCAGG - Intronic
946254518 2:218433013-218433035 ATGGAGAAGGGGATGGGTGGTGG + Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946390696 2:219415082-219415104 TGGGAGGAGGGGAAGGTGGAGGG + Intergenic
946467943 2:219929236-219929258 ATAGAGAAGAGGAAGTTGACTGG + Intergenic
946507847 2:220320737-220320759 ATGGAAACGGGGAAGGAGGGAGG + Intergenic
946881956 2:224185408-224185430 AGAGAGAAGGGGGAGGTGCCAGG + Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
946944668 2:224808492-224808514 ATGGAGAAAGGACAGGAGGCTGG + Intronic
947047887 2:226008863-226008885 ACGGAGGAGGGGCAGGTGGTGGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947206779 2:227667986-227668008 ATGGAGAAAGGGCAGGTGGCAGG - Intergenic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947742806 2:232492583-232492605 ATGGAGGAAGGGCAGGAGGCAGG - Intergenic
947830238 2:233134397-233134419 ATGGAGAAGGAGGAGCTGGGAGG + Intronic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
947958225 2:234213104-234213126 ATGGAGAGGGGGAGGGTGCATGG + Intergenic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948558565 2:238835263-238835285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558591 2:238835344-238835366 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948698683 2:239747308-239747330 AAGCAGGAGGGGAAGGTGCCGGG + Intergenic
1168811261 20:706251-706273 AGAGAGAAGGCCAAGGTGGCTGG + Intergenic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1169178631 20:3542573-3542595 AGGGAGAAGGGGAAGGAGAAAGG - Intronic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1170131138 20:13021559-13021581 GTGGAGGTGGGGATGGTGGCGGG - Intronic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170579241 20:17685250-17685272 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1170733525 20:18994028-18994050 ATGTAGCAGGGGACTGTGGCTGG + Intergenic
1170733633 20:18994879-18994901 ATGTAGCAGGGGATTGTGGCTGG + Intergenic
1171400304 20:24868858-24868880 GGGGAGCAGGGGAAGGTGGGAGG - Intergenic
1172113990 20:32563073-32563095 AGGGTGAAGGGGAAGGAGGGTGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172485208 20:35293806-35293828 CTGGAGGAGGGGAAGAAGGCTGG - Intergenic
1172936604 20:38624969-38624991 ATGGAGGAGGGGAATGTGCTTGG - Intronic
1173162691 20:40664238-40664260 ATGGAGACGGGGAGGGTGTGAGG - Intergenic
1173248762 20:41353648-41353670 CATGAGTAGGGGAAGGTGGCTGG - Intronic
1173461283 20:43245269-43245291 ATGGGGATGGGGAAGGGGACAGG - Intergenic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1173966267 20:47115165-47115187 TGGGAGAAGGGTAAGGTGGTGGG - Intronic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174733666 20:52943010-52943032 TTGGAGAAGGGGAAGGTATTAGG - Intergenic
1174735585 20:52962730-52962752 GTAAAGAAAGGGAAGGTGGCTGG - Intergenic
1174842817 20:53915962-53915984 TGGGAGTAGGGGAGGGTGGCCGG + Intergenic
1175126340 20:56754809-56754831 AGGGAGAAGGGGAAGGGTGTTGG - Intergenic
1175228819 20:57460819-57460841 ATAGGGGAGGGGGAGGTGGCAGG - Intergenic
1175578272 20:60079021-60079043 ACGGTGATGGGGAGGGTGGCTGG - Intergenic
1175598971 20:60257379-60257401 TTGGAGGAGGGGAAGATGGGAGG - Intergenic
1175841904 20:62033288-62033310 AGGCAGAAGAGGGAGGTGGCAGG + Intronic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1176084639 20:63290382-63290404 ATGGGGAAGACGAAAGTGGCGGG + Intergenic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1176546533 21:8204703-8204725 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176554427 21:8248894-8248916 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176565484 21:8387750-8387772 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176573349 21:8431918-8431940 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1177114869 21:17073355-17073377 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1177114947 21:17073995-17074017 AGAGAGAAGGGGAAGGTGACAGG - Intergenic
1177125887 21:17192625-17192647 GCAGGGAAGGGGAAGGTGGCTGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177922432 21:27169317-27169339 ATGGTGAAAGAGAAGGTGTCAGG - Intergenic
1179375889 21:40849342-40849364 AAGGAGAGGTGGCAGGTGGCAGG + Intergenic
1179401631 21:41089868-41089890 GTGGAGCTGGGGGAGGTGGCTGG - Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179902405 21:44401012-44401034 GAGGAGAAAGGGAAGGAGGCAGG - Intronic
1179908054 21:44434345-44434367 ATGGTGACGGGGACTGTGGCGGG + Intronic
1179908071 21:44434399-44434421 ATGGTGGCGGGGACGGTGGCAGG + Intronic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180090380 21:45531102-45531124 ACGGGGCAGGGGGAGGTGGCAGG + Intronic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1180611360 22:17100323-17100345 AGGGAGGAAGGGAAGGTGGATGG - Intronic
1180786522 22:18550738-18550760 GTGGAGAAGGGGAAGATGCCTGG + Intergenic
1180831934 22:18910981-18911003 CTGGAGAAGGCGGGGGTGGCTGG + Exonic
1180905836 22:19410655-19410677 CAGGAGAAGAGCAAGGTGGCAGG + Intronic
1180937710 22:19637057-19637079 ATGAAGTAGGGCAAGGTGGGAGG - Intergenic
1180960731 22:19761174-19761196 AAGAAGAACGCGAAGGTGGCCGG + Exonic
1181067911 22:20315361-20315383 CTGGAGAAGGCGGGGGTGGCTGG - Exonic
1181131803 22:20736461-20736483 GTGGAGAAGGGGAAGATGCCTGG + Intronic
1181243442 22:21490291-21490313 GTGGAGAAGGGGAAGATGCCTGG + Intergenic
1181431126 22:22882493-22882515 ATGGAGCAGGGGGAGGAGCCAGG - Intronic
1181599720 22:23942322-23942344 CTGGAGAAGTGGGAGGTGCCTGG + Intergenic
1181822953 22:25489902-25489924 AGGGAGAAGTGGAGGGTAGCAGG - Intergenic
1181880972 22:25979792-25979814 ATGGAGAAGGGGAAGGGAAAGGG - Intronic
1182157728 22:28091530-28091552 ATGAAAAAGGGAAAGGTAGCAGG + Intronic
1182192511 22:28477442-28477464 ATTGAGAAGGCCAATGTGGCTGG - Intronic
1182318775 22:29464860-29464882 CGGGAGAAGGGGAAGGGGCCTGG - Intergenic
1182408347 22:30158566-30158588 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183222682 22:36526883-36526905 ATGGAAAAGACTAAGGTGGCTGG - Intronic
1183334043 22:37236638-37236660 GTGGAGGAGGGGAATGGGGCAGG + Intronic
1183488276 22:38102015-38102037 ATGGAGCAGTGGGAGGTAGCTGG + Intronic
1183523961 22:38313062-38313084 ATGGAGACGGGGACGGAGACTGG - Intronic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184866867 22:47206223-47206245 ATGGAAAATGGAGAGGTGGCAGG + Intergenic
1184965072 22:47965639-47965661 ATAGGGAAGGGGAAGAGGGCCGG + Intergenic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185229842 22:49673620-49673642 AGGGAGAGGGGGAAGGGGGAGGG + Intergenic
1185273319 22:49938439-49938461 ATGGAGAAGGCGGATGGGGCAGG + Intergenic
1185420884 22:50733750-50733772 AGGGAGCAGGGGATGCTGGCAGG - Intergenic
1203251396 22_KI270733v1_random:120965-120987 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203259442 22_KI270733v1_random:166039-166061 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203282012 22_KI270734v1_random:136252-136274 CTGGAGAAGGCGGGGGTGGCTGG + Intergenic
949329094 3:2901480-2901502 ATGGAGAAGGTGCATGAGGCAGG - Intronic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
950434151 3:12968353-12968375 GTGGAGAAAGGGTAGGGGGCTGG - Intronic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
950505716 3:13393239-13393261 ATGGACAAGGGGATGGAGGTGGG + Intronic
950627773 3:14260687-14260709 ATGCAGAAGGGCAAGGTTGGAGG + Intergenic
951516731 3:23567878-23567900 AAGGAGAGGGGGAAGTTGGCAGG + Intronic
951613296 3:24516477-24516499 ATGGGGAAGGAGAAGGTATCAGG - Intergenic
952110145 3:30113345-30113367 ATGGAGAATGAGAAGGTGCTAGG - Intergenic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
952331238 3:32366230-32366252 ATGGGGAAGGGGAAGAGGGTTGG - Intronic
952494637 3:33905018-33905040 ATGGGGCTGGGGAGGGTGGCAGG + Intergenic
952949811 3:38513691-38513713 AAGGAGAAAGGGAAGGAGGGAGG - Intronic
953081387 3:39622166-39622188 ATGGGGGAGGGGATGGGGGCAGG + Intergenic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
953550158 3:43895848-43895870 ATGGAGGTGAGGAAGGGGGCTGG - Intergenic
953757671 3:45661145-45661167 ATGGAGTAGGGGAATGTGGGTGG - Intronic
953965279 3:47300081-47300103 ATGGAGAAGGGAAAGAGGACAGG - Intronic
954151149 3:48657751-48657773 GGGGAGAAGGGAAAGGTGGCTGG - Intronic
954246920 3:49339653-49339675 GTGGAGAAGGGGAAGGTTGGTGG - Intronic
954383671 3:50233139-50233161 ATGGAGAAGGAGCAGCTAGCAGG + Intronic
954435976 3:50496550-50496572 ATGGATGAGGGGATAGTGGCTGG + Intronic
954447552 3:50554756-50554778 AGGCAGAAAGTGAAGGTGGCTGG + Intergenic
954484702 3:50836966-50836988 ATGGAGAAGGGGAACTTGTTGGG - Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956419991 3:69077867-69077889 CTGGAGACTGGGAAGGTCGCTGG - Exonic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
957258875 3:77874688-77874710 ATGTTGAAGGGGAAGGGGTCAGG + Intergenic
957640763 3:82850316-82850338 AAGGAAAAGGGGAAGGTGAAGGG - Intergenic
958838961 3:99180043-99180065 AGGGAGAAAGGGAAGGGTGCTGG + Intergenic
959240909 3:103792500-103792522 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
959473518 3:106782499-106782521 ATGGAGATGGGGAGGGTGTTGGG - Intergenic
959539742 3:107524810-107524832 GGGGCGAAGGGGAAGGTGGGTGG + Intronic
959919029 3:111850294-111850316 AGGGAGAAGGTGAGGGGGGCAGG + Intronic
960696625 3:120402702-120402724 ATGGAGAAGAGGGCGGTGGCTGG - Intronic
961366497 3:126402891-126402913 ATGGTGAGGGTGCAGGTGGCAGG + Intronic
961386738 3:126527085-126527107 GTGGAATAGGGGAAGGGGGCTGG - Intronic
961650731 3:128415583-128415605 ACAGAGCAGGGCAAGGTGGCAGG - Intergenic
961781487 3:129323325-129323347 GTGGAGAACGAGAGGGTGGCAGG - Intergenic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
962246398 3:133797929-133797951 AGGGAGAAGGGGAAGGGTGAAGG + Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962265658 3:133942659-133942681 AAGGAGATGAGGAAGATGGCCGG + Exonic
962878519 3:139554309-139554331 AGGGAGAAAGGAAAGCTGGCGGG - Intergenic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
963267852 3:143256694-143256716 ATAGAGAAGGGGCAGGAGACTGG + Intergenic
963307831 3:143673560-143673582 ATGGAGTAGGGAAGGGTGGGAGG + Intronic
963676747 3:148321936-148321958 ATGGAGAGGGGGAATGTCTCAGG + Intergenic
963837413 3:150071054-150071076 CTGGACAAGGGGAGAGTGGCAGG + Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964202878 3:154137899-154137921 ATGGAGAAGGGGATAGAGACTGG - Intronic
964712129 3:159682382-159682404 AAGTAGCATGGGAAGGTGGCTGG + Intronic
964833299 3:160910172-160910194 AAGGGGAAGGGGAAGGGGACAGG - Intronic
964892877 3:161557849-161557871 GTGGAGCAGGGGCAGGTGGGAGG - Intergenic
964934155 3:162060644-162060666 AAGGTGAAGGGGAAGCAGGCAGG + Intergenic
965742794 3:171893843-171893865 AAGGAGAGAGGGAAGGAGGCAGG - Intronic
966191264 3:177273784-177273806 ATGGAGTGGGGGAAGGGGGGAGG - Intergenic
966299982 3:178467837-178467859 ATGGAAAAGAGAAAGGGGGCAGG + Intronic
966318742 3:178677513-178677535 GGGCAGCAGGGGAAGGTGGCTGG - Intronic
966437852 3:179908610-179908632 ATGGAGTAGGGGGAGGGGGGAGG - Intronic
966834500 3:184038671-184038693 AGGGAGACAGGGAAGGAGGCAGG - Intronic
966843294 3:184106389-184106411 AGGGAGACAGGGAAGGAGGCAGG - Intronic
967035739 3:185647223-185647245 GTGGAGCAGGGGAAGGAGGGGGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967189933 3:186976256-186976278 ACGGAGGAGGGGAAGGTTGGGGG - Intronic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967913452 3:194560434-194560456 CTGGAGAATGGGCAGGTGGGTGG - Intergenic
968135629 3:196217639-196217661 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968481144 4:833569-833591 AGGAAGAGGGGGAAGGTGGAAGG + Intergenic
968484087 4:850384-850406 AGGGAGAAGGGGATGGTCCCTGG + Intronic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968534178 4:1113203-1113225 GTGGAGAAGGGGGAGGGGGCAGG - Intronic
968647983 4:1749410-1749432 GTGGGGAAGGGGGAGGTGGGGGG - Intergenic
968703822 4:2069186-2069208 GGGGAGAAGGGGGAGGCGGCGGG - Intergenic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968812931 4:2808293-2808315 ATGGAGTAGGAGAAGATGCCTGG - Intronic
968912063 4:3481410-3481432 ATGGACAAGGGGAGGAGGGCCGG + Intronic
968933517 4:3597247-3597269 CCGGACAAGAGGAAGGTGGCAGG + Intergenic
969100605 4:4765416-4765438 ATGGAAGTGGAGAAGGTGGCAGG - Intergenic
969208167 4:5664771-5664793 AGGCAGAAAGGGAAGGTGTCTGG - Intronic
969235930 4:5865065-5865087 ATGGAGGAGGAGGAGGAGGCTGG - Intronic
969306416 4:6328601-6328623 ATGGACAAGGGGGCTGTGGCAGG - Intronic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969467274 4:7365242-7365264 ATGGAGGAAGGAGAGGTGGCTGG + Intronic
969495286 4:7522943-7522965 AGGGAGAAGGGGAAGGATGGGGG - Intronic
969728195 4:8938308-8938330 GTGGAGAAGGGGCATGCGGCAGG + Intergenic
970211753 4:13717214-13717236 ATGGAGGAGGGAAGAGTGGCTGG - Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
970522458 4:16899361-16899383 TTGGAGAAGAGGGAGGTGGCTGG - Intergenic
970837044 4:20421817-20421839 ATGGAGAAAGGGAAGGAGGGAGG - Intronic
971162190 4:24144695-24144717 ATAGAAAAGGGGAAAGTGGAGGG - Intergenic
971305120 4:25473301-25473323 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
971305123 4:25473307-25473329 AAGGGGAAGGGGAAGGGGACGGG + Intergenic
971346319 4:25815084-25815106 AGGGAGAAGAGGAAGGCAGCTGG + Intronic
971470845 4:27024910-27024932 ATAGAGAAGGGAAAAGTTGCTGG + Intronic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971479047 4:27098317-27098339 AGAGAAAAGGGGAAGGAGGCAGG + Intergenic
971481346 4:27117517-27117539 AAGGAGAATAGGAAGGTGGGTGG - Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
972945516 4:44249782-44249804 AAAGAGGAGGGGAAGGGGGCAGG - Intronic
973087098 4:46078473-46078495 ACAGAGAAAGGGAGGGTGGCAGG + Intronic
973328974 4:48893180-48893202 CGGGGGCAGGGGAAGGTGGCTGG + Intronic
974214953 4:58832991-58833013 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
974592546 4:63972577-63972599 ATGAAGAAAGCAAAGGTGGCTGG - Intergenic
974716801 4:65678378-65678400 ATGGAGAAGGGGAACTTGTTGGG + Intergenic
975360210 4:73460925-73460947 AAGGAGGAGGGGAAGGGGGAGGG - Intergenic
975362362 4:73485704-73485726 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
975425257 4:74217936-74217958 ATGGGGCAGGTGAAGGTGTCAGG - Intronic
977210126 4:94208525-94208547 ATGCTGAAGGGGAAGTTAGCAGG + Exonic
978368761 4:108009249-108009271 AAGGAGAAAAGGATGGTGGCTGG + Intronic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978725271 4:111962235-111962257 ATTGAGAAGGGGAAGATGGTGGG - Intergenic
979307008 4:119158034-119158056 ATGCAGAATGGGAAAGTGGATGG + Exonic
979367020 4:119837429-119837451 AAGGAGAAGGGGATGGGGGAGGG + Intergenic
979798491 4:124876713-124876735 ACGGAGAAGGGGCAGGGGGGCGG + Intergenic
979853542 4:125603389-125603411 AAGGAGAAAGGGAAGAAGGCAGG + Intergenic
980208695 4:129756394-129756416 AAGGAGGAGGGAAAGGTGGGTGG - Intergenic
980511215 4:133790136-133790158 ATGAAGATGGTGAAGGTGGGTGG + Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
981550462 4:145937232-145937254 GTGGAGGAGGGGAAGGGGACCGG + Intronic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
981814005 4:148807656-148807678 AAGGGGAAGGGGAAGGAGGGTGG + Intergenic
981934189 4:150221289-150221311 AAGGAGAAGAGGATGGTGGTGGG - Intronic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
982219929 4:153115558-153115580 ATGGAGCAGGGGAGGGAGGCAGG + Intergenic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
982702430 4:158671741-158671763 AGGGAGAAGAGGGAGGCGGCGGG + Exonic
982903287 4:161035486-161035508 ATGGAGAGAGGGTAGGTAGCTGG + Intergenic
982908305 4:161106078-161106100 AGGGTGAAGGGAAAGATGGCAGG - Intergenic
983046177 4:162989255-162989277 ATAGAGAAAGGGCAGCTGGCAGG - Intergenic
983555065 4:169052600-169052622 AAGGAGAAAGGGAAGCTGGTTGG + Intergenic
984070309 4:175103264-175103286 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
984522193 4:180815180-180815202 ATGGAGATGGGGAAGCCTGCAGG + Intergenic
984725159 4:183013444-183013466 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985202095 4:187494374-187494396 AAGGCGAAGGGGAAGCAGGCAGG - Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985552725 5:541619-541641 GAGGAGCAGGGGAAGGTGGAGGG - Intergenic
985628344 5:1001747-1001769 CTGGAGAAGGGGAAGCCCGCGGG + Intergenic
985896455 5:2752100-2752122 GTGGAGAAGGGGGTGGGGGCGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
985920736 5:2970862-2970884 ATGGAGGAAGGGAAGGTGTGAGG - Intergenic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
985992806 5:3577352-3577374 AAGGTGAAGGGGAAGCAGGCAGG - Intergenic
986024042 5:3833320-3833342 AAGGTGAAGGGGAAGCAGGCTGG - Intergenic
986627122 5:9732494-9732516 ATGGACAAGGGGAAGATGGAAGG + Intergenic
986778788 5:11045368-11045390 AGGGAGGGGGGGAAGGTGCCAGG + Intronic
987029516 5:13963035-13963057 AGGGAGAGGGAGAAGGTGGCTGG - Intergenic
987061382 5:14247063-14247085 GTGGGGAAGGGGGAGGTGGGGGG - Intronic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988987009 5:36630163-36630185 TGGGAGAAGGGGGAGGGGGCGGG + Intronic
989611332 5:43295412-43295434 ATGGAAAAGGGCATGGGGGCAGG + Intronic
990295475 5:54397653-54397675 ATGGAGGAAGGGAAGGAGGGAGG - Intergenic
990797197 5:59556888-59556910 AGGAAGAAAGGGAGGGTGGCAGG + Intronic
991102229 5:62805320-62805342 AGAGAGAAGGGGAAGGTGATAGG - Intergenic
992185998 5:74245210-74245232 AAGGAGATGGGGAAGGTAGGGGG - Intergenic
992552146 5:77868988-77869010 GGGGAGAAGGGGAAGCTGGGTGG + Intergenic
993263599 5:85693702-85693724 AAGGTGAAGGGGAAGCAGGCAGG + Intergenic
993387379 5:87275862-87275884 ATGAAGAAGGCCAAGCTGGCTGG - Intronic
993901150 5:93584922-93584944 AAGGGGAAGGGGAAGGGGGGAGG - Exonic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994162071 5:96567938-96567960 ATGGAGGAGGAGAGGGTGGCAGG + Intronic
995217750 5:109614610-109614632 TTGGAGAAAAGGAAGCTGGCAGG + Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995463733 5:112429417-112429439 ACAGAGAAGGGGGAGGTGCCAGG + Intergenic
995571771 5:113488627-113488649 AGGGAGGAGGGGAAGGTGGCTGG + Exonic
995616832 5:113973895-113973917 ATGGAGATGGGGAAGATCACAGG + Intergenic
995655716 5:114423909-114423931 ATGGAGAAAGGGAAGGTGCAGGG + Intronic
996695775 5:126393175-126393197 ATGGAAAAGGGGAAAGTGAAGGG - Intronic
997339068 5:133128375-133128397 ATGGATAGGTGGATGGTGGCAGG + Intergenic
997465699 5:134086695-134086717 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
997526418 5:134555915-134555937 ACGGAGAAGGGGAAGGGGCTTGG - Intronic
997578843 5:135004766-135004788 AGGGAGAGGGGGAAGCTGGAAGG + Intronic
997678760 5:135734530-135734552 ATTAAGAAGGGGAAGGGGCCGGG + Intergenic
997854213 5:137358534-137358556 AAGGAAGAGGGGAAGGTGGAGGG + Intronic
997910783 5:137870928-137870950 ATGGAGCTGAGGAAGCTGGCTGG - Exonic
998378491 5:141707548-141707570 ATGGAAGAGGGGCAGGAGGCAGG + Intergenic
998404707 5:141867767-141867789 ATGGGGAAGGGGAAAGGAGCTGG + Intronic
998461544 5:142313811-142313833 ATGGAAAAGAGGAAGGGGGGGGG + Exonic
998477903 5:142436812-142436834 ATGGAGAAAGGGATGGAGGCTGG - Intergenic
999212877 5:149905580-149905602 ATTGAGAGGGTGAAGCTGGCAGG - Intronic
999551721 5:152694874-152694896 ATGGAGAAGGGGATGTCAGCTGG - Intergenic
999730862 5:154475994-154476016 GAGGAGGAGGGGAAGGTGTCGGG + Intronic
1000042428 5:157494747-157494769 TTCGAGAAGGTGAATGTGGCAGG - Exonic
1000111331 5:158111082-158111104 AAGGAGAGGGGTGAGGTGGCAGG + Intergenic
1001288402 5:170439727-170439749 CTGGGGAAGGGGAATGTTGCTGG - Intronic
1001326880 5:170734911-170734933 TTGGAGGTGGGGAAGGTGCCAGG - Intronic
1001400730 5:171444997-171445019 ATGGAGCAGGGGAATGGGGTAGG + Intronic
1001412665 5:171521860-171521882 ATGGAGAAGTGGGAGGAGCCAGG + Intergenic
1001544005 5:172558771-172558793 ATGGAGAAGGGGGAGCTCGGAGG + Intergenic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001791089 5:174458576-174458598 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791098 5:174458600-174458622 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791107 5:174458624-174458646 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001898698 5:175404243-175404265 AAAGAGAATGGGAAGGTGTCAGG - Intergenic
1001920336 5:175594806-175594828 ATGGAGACAGGGAAGGTTGTGGG - Intergenic
1002060311 5:176621729-176621751 AGGGATGAGTGGAAGGTGGCGGG - Intronic
1002298099 5:178242288-178242310 GAGGAGAGGGGGAAGGAGGCAGG - Intronic
1002397304 5:178968033-178968055 TTAAAGACGGGGAAGGTGGCCGG - Intergenic
1002436451 5:179234707-179234729 GGGGAGATGGGGAAGGTGCCAGG - Intronic
1002881724 6:1258328-1258350 ATGGAGAAAGAGACGGTTGCTGG - Intergenic
1003158031 6:3612787-3612809 GTGGAGGAGGGGAAAGTGTCAGG + Intergenic
1003174416 6:3744527-3744549 AGTGAGATGGGGAAGGTGGAGGG + Intronic
1003199714 6:3947832-3947854 AGGGAGGAGGGGATGGTAGCTGG + Intergenic
1003347625 6:5285306-5285328 AGGGAGAAGGGGAGGAAGGCAGG + Intronic
1003899744 6:10643341-10643363 ATGGAGAAGGGGAAGGTCAAGGG - Intergenic
1004246804 6:13985835-13985857 AGGGAGAAGGGGGAAGTGCCAGG - Intergenic
1004603518 6:17173429-17173451 AGGGAGAAGGGGAAGGGGCAGGG + Intergenic
1004710250 6:18162953-18162975 CTGGAGAAGGGGACCGTGGCAGG + Intronic
1004924237 6:20402990-20403012 ATGGAGAAGGGGGTGGGGGAGGG + Intronic
1005594665 6:27368040-27368062 CTGGAGGGGGGAAAGGTGGCAGG - Intergenic
1005878225 6:30032034-30032056 GGGGACAAAGGGAAGGTGGCTGG + Intergenic
1006084307 6:31585590-31585612 ATGGAGAAGGAGATGGGTGCTGG - Intergenic
1006512692 6:34530212-34530234 AGGGAGATGGGGGAGGTGGAGGG - Intronic
1006535867 6:34698187-34698209 ATGTAGAAAGGGAATGTAGCAGG - Intergenic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006567766 6:34974211-34974233 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1006652441 6:35562820-35562842 AAGGAGAAAGGGAAGGGGGTGGG + Intergenic
1006898463 6:37485064-37485086 ATGGGGAAGGGTGGGGTGGCTGG + Intronic
1007116183 6:39344985-39345007 ATGGAAAAGGGGATGGGGGAGGG - Intronic
1007143362 6:39600621-39600643 ATAGAGAAGGAGAAAGTGACTGG - Intronic
1007722216 6:43891735-43891757 AGAGAAAAGGGGAGGGTGGCAGG + Intergenic
1007762097 6:44139224-44139246 ATGGAGAAGGGGAGGGATGAAGG - Intronic
1008111245 6:47497356-47497378 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1008437783 6:51496458-51496480 CTGGAGAAGGGGATACTGGCAGG - Intergenic
1008489804 6:52074746-52074768 AGGGAGATGGGGGAGGTGGTAGG - Intronic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1009981237 6:70728229-70728251 ATGGAAAAGGGGAAGAGGCCAGG + Intronic
1010595390 6:77756673-77756695 AGAGAGAAGGAGAAGGCGGCGGG - Intronic
1010903726 6:81459309-81459331 ATGGAAAAGAGGAAGGTCACAGG + Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011365432 6:86576576-86576598 GTAGGGAAGGGGAAGGGGGCAGG - Intergenic
1011768350 6:90648805-90648827 ATGGATAAGGGCGAGCTGGCAGG + Intergenic
1012345020 6:98174482-98174504 ATGTAGCAGGGGAAGGATGCAGG + Intergenic
1012464045 6:99497247-99497269 ATGGGGAAGGGGGAGGTAGAGGG + Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015645214 6:135379941-135379963 AGGGAGAAGGGGAAGGAGGGAGG - Intronic
1015903305 6:138089900-138089922 ATTGAGGAGGGGAAGAAGGCTGG + Exonic
1015997885 6:139013621-139013643 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1017339565 6:153305195-153305217 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017523895 6:155226161-155226183 ATGAAGAATGGGATGGGGGCAGG - Intronic
1017751268 6:157492315-157492337 GTAAAGAAGGGCAAGGTGGCTGG - Intronic
1017786809 6:157763253-157763275 AGGGAAAAGGGGAGGGCGGCGGG + Intronic
1018140544 6:160829681-160829703 AGGGAGAAAGGGAAGGAGGAGGG + Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018757971 6:166865920-166865942 ATGGAGAAGGGGAGGGAAGGAGG + Intronic
1018808939 6:167283532-167283554 AGTGGGAAGGGTAAGGTGGCAGG + Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1019155004 6:170032797-170032819 ATGGAGAACTGGAGGGTGCCAGG - Intergenic
1019191205 6:170251967-170251989 AAGGAGAAGTGAATGGTGGCTGG - Intergenic
1019506122 7:1392382-1392404 AGGGAGGAGGGGGAGGTGCCAGG - Intergenic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1020450510 7:8315924-8315946 ATGGGGAATGGGCAGGTAGCAGG + Intergenic
1020845983 7:13284376-13284398 AGGGAGAAGGCTCAGGTGGCTGG - Intergenic
1021380467 7:19959797-19959819 AAGGTGAAGGGGAAGCAGGCAGG - Intergenic
1022096966 7:27147261-27147283 AGGGAGAGGGGAAAGGAGGCAGG - Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022274426 7:28841823-28841845 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022357055 7:29625792-29625814 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1022779346 7:33562627-33562649 ATAGAAAAGGGAAAGGAGGCTGG + Intronic
1022973236 7:35536039-35536061 AGGGAGAAGGGGAAGGGAGCCGG + Intergenic
1023032951 7:36107027-36107049 ATTGAGATTGGGAAGTTGGCTGG + Intergenic
1023730229 7:43184849-43184871 AAGGTGAAGGGGAAGCAGGCAGG + Intronic
1023834976 7:44062627-44062649 ATGGAGTGGGGGAGGGTGGGTGG + Intronic
1023994318 7:45149809-45149831 AGGGAGCAGGGGAAAGGGGCTGG + Intergenic
1024577089 7:50773399-50773421 AAGGGGAAGGGGAAGGGGACGGG + Intronic
1025597457 7:62949256-62949278 GTGGGGTAGGGGAAGGGGGCAGG - Intergenic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026241727 7:68581429-68581451 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1026800617 7:73397785-73397807 AAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1026828395 7:73597370-73597392 ATGGGGAAGGGGGTGGGGGCTGG + Exonic
1026917461 7:74129531-74129553 AAGGAGAAGGGGAAGGAAGGAGG + Intergenic
1026994570 7:74606977-74606999 TTGGAGCAGGGGAAGGGGGTGGG - Intergenic
1027428246 7:78083343-78083365 AGGGAGAAGGAGATGGTGGGGGG + Intronic
1027564948 7:79780072-79780094 GTGGAGTAGGGGAAGGGGGAAGG - Intergenic
1028225283 7:88243880-88243902 AAGTAGAAGGGGATGGTGGTTGG + Intergenic
1028316932 7:89414314-89414336 ATGGTGAGGTGGAAGGTGGGAGG - Intergenic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1029162542 7:98562969-98562991 AGGGAGGATGGGAAGGTGGGTGG + Intergenic
1029272445 7:99385285-99385307 ATGGGGCAGGGGAAGTTGGGTGG + Intronic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1030295490 7:107921851-107921873 ATGGACAAGGGGATGGGGGTGGG - Intronic
1030644527 7:112045115-112045137 ATGAGGAAGGGGAAAATGGCAGG - Intronic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031539143 7:122972037-122972059 GTGGAGACAGGGAAGGTGACAGG - Intergenic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031865992 7:127039630-127039652 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1032020847 7:128406345-128406367 GGGGAGAAGGGCAAGGTGGGTGG - Intronic
1032513697 7:132491833-132491855 AAGGAGATGGGGAAGGAGACAGG + Intronic
1033033990 7:137853892-137853914 ATGGAGAAAGGGAATGTGAATGG - Intergenic
1033334856 7:140443928-140443950 GTGGAGAAGGGCTAGATGGCTGG + Intergenic
1033804324 7:144937416-144937438 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1034074878 7:148222020-148222042 ATGAAGAAGGGGATGGCAGCTGG - Intronic
1034083557 7:148302700-148302722 ATGGGGAAGGGGAAGTAGGCAGG - Intronic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034450543 7:151134924-151134946 ATGGAGATAGGGGAGGTGGAAGG + Intronic
1034469396 7:151247509-151247531 ATGGGGATGGGGCTGGTGGCGGG - Intronic
1034474899 7:151276429-151276451 GGGGAGGAGGGGAAGGTGCCAGG + Intronic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1035035483 7:155891582-155891604 ATGGTGAAGGGGATGGGGGTAGG + Intergenic
1035053829 7:156020357-156020379 TTGGAGCAGGGGTAGGGGGCAGG + Intergenic
1035109712 7:156470959-156470981 AAGGTGAAGGGGAAGCAGGCGGG - Intergenic
1035670633 8:1414506-1414528 GAGCAGAAGCGGAAGGTGGCGGG + Intergenic
1035681605 8:1492720-1492742 ATGGAGCCGGGGAAGGTGCCTGG - Intergenic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1036612983 8:10366000-10366022 AAGGAGCAGGGGAATGAGGCAGG - Intronic
1036718041 8:11144894-11144916 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1036773302 8:11593263-11593285 AGGGAGGAGGGGAAGATGGGTGG - Intergenic
1036788544 8:11703388-11703410 ATGGGGGAGGGGAATGTGTCAGG - Intronic
1037236961 8:16731401-16731423 ATGAAGTAAGGGAAGGTGGCAGG - Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039400332 8:37263654-37263676 AAGGAAAAGGGGAAGCAGGCAGG + Intergenic
1039413554 8:37375373-37375395 AGGGAGAAAGGGATGGGGGCTGG - Intergenic
1039515388 8:38128366-38128388 ATGGAGTACGGAAAGGTGCCTGG + Exonic
1039765847 8:40626797-40626819 ATGGAGCTGGGGAGGGGGGCTGG + Intronic
1041000602 8:53446669-53446691 ATGGAGTAGGGGGAGGGGGAGGG + Intergenic
1041125658 8:54635955-54635977 AGGGAGAAAGGGAAGGAGGGAGG - Intergenic
1041248710 8:55914068-55914090 ATGGAGAATGGAGAGGTGGAGGG + Intronic
1041565843 8:59277831-59277853 ATGGAGTATGGGAAGCAGGCAGG + Intergenic
1041586142 8:59522087-59522109 GTGGAGAGGGGGAGGGTGGGTGG + Intergenic
1042039593 8:64577971-64577993 AGGGAGAGGAGGGAGGTGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042856559 8:73273463-73273485 CTGGAGAGGGCCAAGGTGGCAGG - Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043156941 8:76794843-76794865 ATAGAGATGGAGAAGGCGGCTGG + Intronic
1043161479 8:76852933-76852955 AGGGAGGAGGAGGAGGTGGCGGG - Exonic
1043750969 8:83933720-83933742 ATGGAGATGAGTAAGGTGTCAGG + Intergenic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044492367 8:92834608-92834630 GTGGAGAAGGGACAGGTGGAGGG - Intergenic
1044586025 8:93869795-93869817 AGGGAGAAGGGGAGGCCGGCAGG - Intronic
1044728540 8:95212461-95212483 AAGGAGAAGGAGAAGGTGATGGG + Intergenic
1044782016 8:95752856-95752878 ATGGATAAGGGGAAGGTGTTGGG - Intergenic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045211878 8:100107235-100107257 ATGGAGAGGTGGGAGGTGGGGGG + Intronic
1045322519 8:101092557-101092579 AAGGAGGATGGGAAGGGGGCAGG - Intergenic
1046110208 8:109713785-109713807 ATGGAGACCTGGAAGGTTGCAGG + Intergenic
1046218346 8:111179830-111179852 ATGGGGTAGGGGAAGGGGGGAGG - Intergenic
1046708313 8:117480131-117480153 GTGGTGAAGGGGGAGGTGGGAGG + Intergenic
1046850162 8:118963067-118963089 ATGCAGAGGGGGAAGGGAGCCGG + Intergenic
1046922695 8:119749798-119749820 ATGGGGAAAGGGGAGGTAGCTGG - Intronic
1047056816 8:121174223-121174245 TTGGAGGAGAGGAAGCTGGCCGG + Intergenic
1047369996 8:124248106-124248128 AGGGAGAAAGGGAAGCAGGCCGG + Intergenic
1047523724 8:125615286-125615308 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1047907179 8:129484699-129484721 AAGGAGAGGAGGAAGGTGGGAGG - Intergenic
1048214783 8:132484131-132484153 ATGGAGGAGGGGAAGCAGGTGGG - Intergenic
1048970774 8:139643866-139643888 ATGGTGCAGAGGAAGGGGGCTGG - Intronic
1049108298 8:140627113-140627135 ATGCAGGGCGGGAAGGTGGCGGG - Intronic
1049349853 8:142158753-142158775 ATGGGCCAGGGGAAGGCGGCCGG - Intergenic
1049446097 8:142632324-142632346 GTGGGCAAGGGGCAGGTGGCAGG + Intergenic
1049665032 8:143839262-143839284 ACGGGGCAGGGGAAGGTGCCTGG - Intronic
1049724595 8:144139802-144139824 GTGCAGAAGGTGGAGGTGGCAGG + Exonic
1049734692 8:144198794-144198816 TAGGAGAGGTGGAAGGTGGCAGG + Intronic
1049802637 8:144525277-144525299 GTGGAGAAGGAGAAGGTGACAGG - Intronic
1050358550 9:4805396-4805418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1050879136 9:10677056-10677078 ATGGAGGAGGCTGAGGTGGCCGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1051886572 9:21899396-21899418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1052976789 9:34417051-34417073 AAGGAGAAGGGGAAGGGGAAAGG - Intronic
1053330892 9:37206287-37206309 AGGGAGAGGGGGAAGGGGGAAGG - Intronic
1053450690 9:38191985-38192007 GGGGAGAAGGGAAAGGAGGCTGG - Intergenic
1053453742 9:38214719-38214741 AAGGAGAAGGGGAAAGGGGTTGG + Intergenic
1053517910 9:38747186-38747208 ATGGAGCAGGGGGCCGTGGCTGG + Intergenic
1053551240 9:39081425-39081447 ATAGAGAATTGGAAGGGGGCTGG - Intronic
1053815351 9:41901522-41901544 ATAGAGAATTGGAAGGGGGCTGG - Intronic
1054615245 9:67285918-67285940 ATAGAGAATTGGAAGGGGGCTGG + Intergenic
1054981257 9:71209385-71209407 AGGGAGAGGGGGAAGGAGGGAGG + Intronic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1055993710 9:82134726-82134748 ATTGAGAAAGGGAAGATGGCAGG - Intergenic
1056832354 9:89927510-89927532 TTTGGGAAGGGGAAGTTGGCAGG - Intergenic
1056848646 9:90062101-90062123 ATAGGGAAGAGGTAGGTGGCAGG - Intergenic
1057220134 9:93253101-93253123 ATGGGGATGGGGAAGGGGGTGGG - Intronic
1057739761 9:97701160-97701182 AAGGAGGAGGGGATGGTGGTGGG - Intergenic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059325921 9:113503981-113504003 AAGGGGAAGGGGGAGGAGGCAGG - Intronic
1059474030 9:114529553-114529575 GTCGAGAAGTGTAAGGTGGCTGG + Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059730233 9:117049974-117049996 AAGGAGAAAGGAAAGGTGGTGGG + Intronic
1060001865 9:119966102-119966124 TTGGAAAGGTGGAAGGTGGCAGG - Intergenic
1060013365 9:120064437-120064459 AAGGAGAAGGGGAAGTGAGCAGG - Intergenic
1060257838 9:122048072-122048094 AGGGAGATGGGGGAGGAGGCTGG - Intronic
1060372398 9:123086690-123086712 AGGGAGAAAGGGAGGGTGGGAGG + Intronic
1061205762 9:129162363-129162385 AGGGACCAGGAGAAGGTGGCAGG + Intergenic
1061245111 9:129397571-129397593 ATGGATAAGGGGATGGTTGAAGG + Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061928877 9:133822041-133822063 GGGCAGAAGGTGAAGGTGGCAGG - Intronic
1061947392 9:133916386-133916408 TTGTAGAAAGGGAAGGTGGTGGG + Intronic
1061947441 9:133916576-133916598 ATGGAGAAGGGGAAAGGAGGGGG + Intronic
1061979031 9:134089314-134089336 AAGAAGAAGGGAAAGATGGCTGG + Intergenic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062110730 9:134780775-134780797 AGTGAGAAGAGAAAGGTGGCCGG - Intronic
1062532228 9:137007018-137007040 AAGGCTAAGGGGAAGGGGGCCGG + Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1202630204 M:10194-10216 ATGGAGAAAGGGACGCGGGCGGG - Intergenic
1203467798 Un_GL000220v1:104116-104138 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203475623 Un_GL000220v1:148092-148114 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185665206 X:1760098-1760120 AAGGAGAAGGGGAAGGAAGGAGG - Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186264634 X:7818805-7818827 AAGGAGAAGGGGAAGGAGTAGGG + Intergenic
1186862343 X:13685556-13685578 TCAGAGAAGGGGATGGTGGCTGG + Intergenic
1186908748 X:14139049-14139071 AAGGAGAAGGGGGAGAAGGCAGG + Intergenic
1187596425 X:20777552-20777574 ATGGGGTAGGGGAAGGGGGGCGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188702031 X:33277114-33277136 ATGGATTGGGGGAAGGTGGCAGG - Intronic
1189123858 X:38425047-38425069 ATGGGGAACGGGAAGCTGGCTGG + Intronic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189408615 X:40749096-40749118 ATGGACTATGGGAAGGCGGCTGG + Intergenic
1189684401 X:43548820-43548842 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1190109704 X:47582207-47582229 GTGGAGGTGGGGGAGGTGGCTGG + Intronic
1190118250 X:47639546-47639568 ATAGATAAGGGGAATCTGGCGGG - Intronic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190336026 X:49262229-49262251 ATAAAGAAGGGCAAGGTGCCAGG + Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190561953 X:51694986-51695008 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1191851121 X:65587221-65587243 AAGGGGAAGGGAAAGGGGGCGGG + Intergenic
1192258873 X:69491429-69491451 ATGGAGACGGGGGTTGTGGCTGG + Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1192448953 X:71230885-71230907 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1193463135 X:81813655-81813677 AAGGTGAAGGGGAAGCAGGCAGG - Intergenic
1193854054 X:86576831-86576853 AGGGAGATGAGGAAGGTGTCAGG - Intronic
1194952568 X:100144632-100144654 ATGGAGATGGGGAACTTGCCTGG + Intergenic
1195436785 X:104853470-104853492 ATGATGAAGGGGAATGTGGGAGG + Intronic
1195513315 X:105742886-105742908 ATGGAGATGGAGAAGGGGACTGG - Intronic
1195921411 X:109987559-109987581 ATGGAGAAATGGAAGGAGACAGG + Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1197903090 X:131394296-131394318 ATAGAGAAGGGGAGGCTGGATGG - Intronic
1197980711 X:132216512-132216534 AGAGAGAAGGGGAGGGCGGCGGG + Intronic
1198218424 X:134578031-134578053 AATTACAAGGGGAAGGTGGCAGG + Intronic
1198831560 X:140756493-140756515 ATGGAATAGGGGAAGGGAGCAGG + Intergenic
1199453229 X:147996999-147997021 ATGGAGGAGGGGAAAAAGGCTGG + Intronic
1199572063 X:149276187-149276209 AATGAGAAAGGGAAGGAGGCAGG - Intergenic
1199895635 X:152125081-152125103 AGGGAGAAAGGGAAGGAGGGAGG - Intergenic
1199895642 X:152125101-152125123 AGGGAGAAAGGGAAGGAGGGAGG - Intergenic
1200229104 X:154435257-154435279 ATGAACCTGGGGAAGGTGGCAGG - Exonic
1200230415 X:154441154-154441176 ATGGAGAACGGCAAGGTGGTGGG + Exonic