ID: 1184152130

View in Genome Browser
Species Human (GRCh38)
Location 22:42645416-42645438
Sequence TGTGCTCTTGGAGGACAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 297}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184152130_1184152137 -8 Left 1184152130 22:42645416-42645438 CCCGCTTGTCCTCCAAGAGCACA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1184152137 22:42645431-42645453 AGAGCACAGGCCTCAGAGGTGGG 0: 1
1: 0
2: 5
3: 43
4: 361
1184152130_1184152136 -9 Left 1184152130 22:42645416-42645438 CCCGCTTGTCCTCCAAGAGCACA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1184152136 22:42645430-42645452 AAGAGCACAGGCCTCAGAGGTGG 0: 1
1: 0
2: 2
3: 51
4: 354
1184152130_1184152140 4 Left 1184152130 22:42645416-42645438 CCCGCTTGTCCTCCAAGAGCACA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1184152140 22:42645443-42645465 TCAGAGGTGGGCTTAGGATCCGG 0: 1
1: 0
2: 0
3: 12
4: 172
1184152130_1184152138 -2 Left 1184152130 22:42645416-42645438 CCCGCTTGTCCTCCAAGAGCACA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1184152138 22:42645437-42645459 CAGGCCTCAGAGGTGGGCTTAGG 0: 1
1: 1
2: 1
3: 33
4: 328
1184152130_1184152141 11 Left 1184152130 22:42645416-42645438 CCCGCTTGTCCTCCAAGAGCACA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1184152141 22:42645450-42645472 TGGGCTTAGGATCCGGCTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184152130 Original CRISPR TGTGCTCTTGGAGGACAAGC GGG (reversed) Intronic
901649726 1:10736732-10736754 TGTACTCCTCAAGGACAAGCTGG - Intronic
902374914 1:16026145-16026167 TGTGATCTTGGAGGACTACCTGG + Exonic
902379880 1:16047942-16047964 TGTGGTCTTGGAGGACTACCTGG + Exonic
902595710 1:17508208-17508230 TGTGCTGTGGGAGGCCATGCTGG + Intergenic
903050141 1:20594538-20594560 GGTGCTTTTGGAGGCCGAGCTGG + Intronic
903153843 1:21430890-21430912 TATGCCCTAGGAGGCCAAGCTGG + Intergenic
903688259 1:25148613-25148635 TGTGCTCATGGAAGACAACCAGG - Intergenic
904874637 1:33644617-33644639 TATGCACTTGGAGGACTAGCGGG + Intronic
906462385 1:46044980-46045002 TGTGCCCTTAGAGGGCAAGGTGG - Intronic
906553898 1:46691382-46691404 TGTGCTCGTGGATGAAAGGCAGG - Intronic
906985147 1:50675135-50675157 AGTGCTTTGGGAGGCCAAGCGGG - Intronic
907177472 1:52538413-52538435 AGCACTTTTGGAGGACAAGCTGG + Intronic
907468278 1:54654027-54654049 TGTGCCCCTGGAGGAGAATCTGG + Exonic
909660319 1:78075207-78075229 AGCGCTTTTGGAGGCCAAGCAGG + Intronic
912258274 1:108083254-108083276 TGAGCTCTTGGAGGATAAGTAGG - Intergenic
912920100 1:113858303-113858325 TGTACTCTGGGAGGCCAAGAGGG - Intronic
913030392 1:114897044-114897066 TGTGCACTGGGAGGACAGGCTGG - Intronic
916194429 1:162210275-162210297 CGTGCTCTTGAAGGTCGAGCTGG - Intronic
919018062 1:192066565-192066587 TGTGCTTTTGGAGGCCGAGGTGG - Intergenic
919791536 1:201293804-201293826 TGAGCTCCTGGAGGAGAAGGTGG - Intronic
920825606 1:209421893-209421915 TTTGCTTTTGGAGGACTAGGAGG - Intergenic
921853596 1:219956564-219956586 AGTGCTTTGGGAGGCCAAGCAGG + Intronic
924042088 1:239993412-239993434 TTTGCTCTTGTAGCACAGGCTGG - Intergenic
924118704 1:240774206-240774228 TTTGCTCTTGTAGCACAGGCTGG + Intergenic
924384174 1:243487427-243487449 TCTGATCTTGGAGGAAAAGTAGG - Intronic
1063372968 10:5533638-5533660 TGTGCTCTGGGAGGAGATGCTGG + Intergenic
1063923694 10:10956678-10956700 AGTGCTTTAGGAGGCCAAGCCGG + Intergenic
1065357355 10:24855544-24855566 AGTGCTTTGGGAGGACAAGGTGG + Intronic
1065730602 10:28706559-28706581 AGTGCTCTGGGAGGCCAAGGTGG - Intergenic
1067836844 10:49646684-49646706 TGTGCTCTTGCAGGGCCACCTGG - Intronic
1068372849 10:56141251-56141273 TTTGCTCTTGTAGCCCAAGCTGG + Intergenic
1069062712 10:63910981-63911003 TGTGCTCTGTGTGGACCAGCAGG - Intergenic
1069287534 10:66734614-66734636 AGTGCTCTGGGAGGCCAAGGCGG + Intronic
1069682449 10:70294978-70295000 TGGGGTGTTGGAGGACCAGCTGG + Intergenic
1070540111 10:77409618-77409640 TGGGCCCTTTGAAGACAAGCAGG - Intronic
1070711422 10:78685902-78685924 TGCTCTCTTGGCCGACAAGCAGG + Intergenic
1071691587 10:87825812-87825834 AGTGCTTTGGGAGGCCAAGCTGG - Intronic
1072371796 10:94771944-94771966 TGTGGTCTACGAGGACAGGCAGG - Intronic
1073135091 10:101215935-101215957 TGTGCTTTTGAAGGAGAAGACGG - Intergenic
1073310999 10:102541736-102541758 TTTGCTCTTGGTGCCCAAGCTGG + Intronic
1073833095 10:107409427-107409449 TGTGTCATTGGAGGACAACCTGG + Intergenic
1074773074 10:116745752-116745774 TGTGATCTTGGAGGGCTAGGTGG - Intergenic
1076017652 10:127041117-127041139 TGTGCTCTTGTTGGCCAGGCTGG + Intronic
1076568678 10:131416585-131416607 TGTGCTTTTGGAGCACAGGACGG - Intergenic
1079096194 11:17511819-17511841 TGTGCTCCCAGAGGACCAGCTGG - Intronic
1079171290 11:18098163-18098185 TAAGCTCTTGGAGGACAAGAAGG - Intronic
1079643140 11:22831341-22831363 TGTACTTTTGGAGGCCAAGGTGG + Intergenic
1080545234 11:33310554-33310576 AGTACTCTGGGAGGCCAAGCTGG - Intronic
1081421271 11:42876395-42876417 TGTGGTCCAGGAGGACAGGCAGG + Intergenic
1081544719 11:44062655-44062677 TGTGCACTGGGAGAACAAGATGG + Intergenic
1081605195 11:44522991-44523013 GGTGCTCTGGGAGGAAAAACAGG + Intergenic
1083320840 11:61845458-61845480 GGGGCTCTTGAAGGACAAGCAGG + Intronic
1083490636 11:63012791-63012813 TGTGCTCCTGGAGGGAACGCAGG + Intronic
1083643749 11:64160018-64160040 CGTCAGCTTGGAGGACAAGCTGG + Intronic
1083721285 11:64604819-64604841 TGAGCAGTTGGGGGACAAGCAGG + Intergenic
1083934991 11:65865454-65865476 GGTGCTCGTGGAGGTCAAGTGGG + Intronic
1084050872 11:66599132-66599154 GGTGCACTTGGAGGACCAGATGG + Exonic
1084286579 11:68135335-68135357 AGTGCTTTTGGAGGCCAAGGAGG + Intergenic
1084651491 11:70491986-70492008 TGTGCTCTGGGTGGACCAGGAGG + Intronic
1084865528 11:72053231-72053253 AGTGCTCTGGGAGGACAAGGTGG - Intronic
1085897870 11:80661500-80661522 TGTGGCCTTGGAGGACAACTTGG - Intergenic
1086007208 11:82050928-82050950 TGTGCTCCTGAATGACAAGTGGG + Intergenic
1088262664 11:107958870-107958892 AGTGCTCTGGGAGGCCAAGGTGG + Intronic
1093220522 12:16414992-16415014 TTTGCTCTTGTTGGCCAAGCTGG - Intronic
1094608109 12:31966989-31967011 TTTGTTCTTGGAGGACCTGCAGG - Intronic
1096285257 12:50294249-50294271 AGTGCTCTGGGAGGCCAGGCAGG - Intergenic
1098217687 12:68237351-68237373 TGATCTTTTGGAGGACAAGAAGG - Intergenic
1098309472 12:69134043-69134065 AGTGCTCTGGGAGGCCAAGTCGG + Intergenic
1098450406 12:70612485-70612507 TGTCCTTATGTAGGACAAGCAGG - Intronic
1099445238 12:82744024-82744046 TGTGCTCTGGGAGGCCAGGCGGG + Intronic
1101898129 12:108770707-108770729 TGAGCTCCTGGAGGACAGACAGG - Intergenic
1102558564 12:113746024-113746046 TGTGCTCTTGGAGAACACCCAGG - Intergenic
1102899614 12:116626231-116626253 AGTGCTCTGGGAGGCCAAGGTGG - Intergenic
1103877940 12:124143301-124143323 AGTGCTTTGGGAGGCCAAGCAGG - Intronic
1104814972 12:131640329-131640351 TGTGCTCTTGGTGGAATAGGAGG + Intergenic
1105566144 13:21550287-21550309 AGTGCTTTTGGAGGCCAAGACGG + Intronic
1106963796 13:35035271-35035293 TATGCTCCTGAATGACAAGCGGG - Intronic
1107088524 13:36450819-36450841 TGTGCTCTAGGAGGGGAGGCAGG - Intergenic
1107101057 13:36593021-36593043 TGTGATCTTGGAAGAAAAGAGGG - Intergenic
1107926048 13:45262971-45262993 AGTGCTCTGGGAGGCCAAGGGGG - Intronic
1110292849 13:73827026-73827048 TGTGCTTTGGGAGGCCAAGGTGG - Intronic
1110670375 13:78169809-78169831 CATGCTCTGTGAGGACAAGCAGG - Intergenic
1111113120 13:83741633-83741655 AGTGCTTTTGGAGGCCAAGGTGG + Intergenic
1112364079 13:98742094-98742116 TGTGTTCTGGGAGGACCACCAGG - Intronic
1113106306 13:106775217-106775239 AGTGCTGTTGGGGGACAAGCGGG - Intergenic
1113435776 13:110289922-110289944 CATCCTCATGGAGGACAAGCAGG + Intronic
1113451914 13:110416370-110416392 AGTCTTCTTAGAGGACAAGCAGG + Intronic
1113516181 13:110901791-110901813 AGTGCTCTGGGAGGCCAAGGTGG + Intronic
1114374888 14:22133660-22133682 TGTTCTGTAGGAGGACAAGCAGG - Intergenic
1114630850 14:24158641-24158663 TCTGATCTTGGAGGCTAAGCAGG + Intronic
1117301404 14:54432202-54432224 GGTACTCTGGGAGTACAAGCTGG + Exonic
1118618788 14:67595779-67595801 TCTGCACTTGGAGGACCAGGTGG + Intronic
1118876870 14:69793439-69793461 TGTGCTCTTGGAACTTAAGCAGG - Intronic
1119366269 14:74094504-74094526 AGTGCTCTGGGAGGCCAAGGTGG - Intronic
1119480087 14:74953585-74953607 TGGGGTCTTGGAGGACAGGGTGG - Intronic
1124851167 15:33340084-33340106 TTTGTCCTTGGAGGAGAAGCAGG - Intronic
1125040419 15:35179174-35179196 TGTGCTCTTGTTGCACAGGCTGG - Intergenic
1125853458 15:42926394-42926416 TTTGCTCTTGTTGGCCAAGCTGG + Intergenic
1127006516 15:54576717-54576739 TGTGCTGGTGGGGGACAAGAGGG - Intronic
1127070711 15:55286144-55286166 TCTGATCTTGGAAGCCAAGCAGG + Intronic
1128198261 15:65779984-65780006 AGTGCTTTGGGAGGCCAAGCAGG - Intronic
1129229545 15:74189157-74189179 CGTGCTCTCCGAGGACAAGCAGG - Exonic
1129423325 15:75447702-75447724 TGGGCTATTGGAGGATATGCAGG - Intronic
1129977611 15:79835358-79835380 TTAGCACTTGGAGGACAAGAAGG + Intronic
1130318052 15:82813478-82813500 TGTGCTTTGGGAGGCCAAGGTGG - Intronic
1131216451 15:90540210-90540232 TGAGATCTTGAAGGATAAGCTGG + Intronic
1131269352 15:90937096-90937118 AGTGCTTTTGGAGGCCAAGATGG + Intronic
1132435349 15:101796464-101796486 TGTGCTCTTTGATAACAAGCTGG + Intergenic
1132739072 16:1402008-1402030 AGTGCTCTGGGAGGCCAAGGTGG - Intronic
1133334222 16:4996331-4996353 TGTCCCCTTGGAGGAGAAGGGGG - Exonic
1134593293 16:15474932-15474954 AGTGCTTTGGGAGGCCAAGCGGG - Intronic
1135711612 16:24722161-24722183 TGTGCTTTGGGAGGCCAAGGTGG + Intergenic
1136412943 16:30087431-30087453 TGTGCTCTCGGAGGTCAGGGAGG - Intronic
1136551935 16:30986544-30986566 TGGGCTCTTAGAGGACAAGAGGG - Intronic
1137044402 16:35642457-35642479 TGTGTTCTTGTAGGCCAGGCTGG + Intergenic
1137698542 16:50478890-50478912 TGTGCTCTTGGAGGAGGGCCAGG - Intergenic
1138257565 16:55580037-55580059 TGTGGTCATGGATGTCAAGCTGG + Intronic
1139482645 16:67239080-67239102 TGGGTTCTTGGAGGAGCAGCTGG - Intronic
1139500507 16:67360387-67360409 TGTGCTGTGGGAGGAAAAACAGG + Intronic
1142133109 16:88439853-88439875 TGTGCTCTTGGGGGACCAGGCGG - Exonic
1143161309 17:4873325-4873347 TGTGCTGTGGGAGAACAGGCTGG - Intronic
1143161319 17:4873405-4873427 TGTGCTGTGGGAGAACAGGCTGG - Intronic
1143161329 17:4873485-4873507 TGTGCTGTGGGAGAACAGGCTGG - Intronic
1143375697 17:6465800-6465822 TGGGGTCTTGGAGGCCAGGCTGG - Intronic
1143526680 17:7477262-7477284 TGTGCTTTTGGAAGATACGCAGG + Intronic
1144907576 17:18648667-18648689 TTTGCTCTTGAAGCACAGGCTGG - Intronic
1146589926 17:34120110-34120132 CGTGATCTTGGAGGCAAAGCAGG - Intronic
1146963356 17:37003853-37003875 AGTGCTCTGGGAGGCCAAGTTGG + Intronic
1149886491 17:60345300-60345322 TGTGTTCTTAGAGGTCAAGTGGG - Intronic
1152132511 17:78485625-78485647 GGTGCTGATGGGGGACAAGCTGG - Exonic
1152666472 17:81572761-81572783 TGTGCTTTTGGAGGATAGACAGG - Intronic
1152679563 17:81659349-81659371 TGTACTTTTGGAGGACGAGGTGG + Intronic
1152835137 17:82524957-82524979 TGCCCTCTTTGAGGACAAGGTGG + Intronic
1154981259 18:21504286-21504308 TGTGCTTTGGGAGGCCAAGGTGG + Intronic
1155274209 18:24170564-24170586 TCTGCTCTTGGAAGCTAAGCAGG - Intronic
1156880193 18:42068486-42068508 AGAGCTCTTGGAGGACAGGTTGG - Intronic
1158483591 18:57844569-57844591 TGTGCTTTGGGAGGCCAAGTAGG + Intergenic
1160705189 19:526259-526281 TGCGCTCTTGGAGGTGAAGGGGG - Intergenic
1161774188 19:6249509-6249531 TGTGGGCTGGGAGGACATGCTGG - Intronic
1162760794 19:12887102-12887124 TGTGCTGATGGAGGGCAAGGCGG + Exonic
1164223340 19:23217798-23217820 TGTGCTTTGGGAGGCCAAGGCGG + Intergenic
1164521354 19:28982520-28982542 TGTGCTCTGAGATGACCAGCTGG + Intergenic
1165006840 19:32814309-32814331 GGAGCTCTTGGGGAACAAGCAGG - Intronic
1165159841 19:33809622-33809644 AGTGCTTTGGGAGGCCAAGCAGG + Intronic
1165668475 19:37655015-37655037 TGGGGTCTAGGAGGACACGCTGG - Intronic
1166318987 19:42004860-42004882 AGTGCTTTGGGAGGCCAAGCCGG - Intronic
1166319166 19:42005871-42005893 TGTGCTCTTGACGAACACGCTGG + Exonic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1167329290 19:48844842-48844864 TTTGCTCTTGTCGCACAAGCTGG + Intronic
1168394149 19:56034015-56034037 AGTGCTCTGGGAGGCCAAGCGGG - Intronic
925972627 2:9117306-9117328 TGTGCTTTGGGAGGCCAAGTTGG - Intergenic
926888958 2:17622885-17622907 TGTGCACTGGGAGGACCAGCTGG - Intronic
930672283 2:54163824-54163846 TTTGCTCTTGGTGGCCAGGCTGG - Intronic
931356979 2:61545962-61545984 TTTGCTCTTGTAGTCCAAGCTGG + Intergenic
937379273 2:121361900-121361922 TGTGCTGTTCTAGGACTAGCAGG + Intronic
937797145 2:126037149-126037171 TTTGCCCTTGGAAGACAAACAGG + Intergenic
937985387 2:127635978-127636000 TGTGATCTTGGAGCCCAGGCAGG - Intronic
938032629 2:128008616-128008638 AGTGCTTTTGGAGGCCAAGGTGG - Intronic
938062977 2:128266785-128266807 TATGCCCTAGGAGGCCAAGCTGG - Exonic
938643291 2:133305058-133305080 TGTGCTGTTGGAGGAACAGAAGG + Intronic
939755024 2:146099792-146099814 TGTACTCTGGGAGGGCGAGCAGG - Intergenic
942813597 2:180025079-180025101 TGTGCTCCAGGAGGTCATGCAGG + Intergenic
942886117 2:180926207-180926229 TGTGGTGTTGGAGGAAAAGAAGG + Intergenic
945192089 2:207199141-207199163 TGAACTCCTGGAGGAGAAGCAGG - Intergenic
945767427 2:213998285-213998307 TGTGTTCTGGGAGGACCAGGTGG + Intronic
947898455 2:233698147-233698169 TGTTCTCTAGGACGACATGCTGG - Intronic
1171385083 20:24764439-24764461 TGTGGGCTTGGAGGTCAGGCGGG + Intergenic
1171946288 20:31380786-31380808 TGTGGTCTTGGTGGAGAAACAGG - Intronic
1172030995 20:31981997-31982019 AGTGCTATTGGAGGACAGCCAGG - Intronic
1172810729 20:37646090-37646112 GGTGGTCTTGGAGCACAAGGGGG + Intergenic
1174616008 20:51836002-51836024 TGTTATATTGGAGGAAAAGCAGG - Intergenic
1176705956 21:10120114-10120136 TGTGCTCTTGGGGGACATCAGGG - Intergenic
1177708303 21:24737753-24737775 TGAGCTCTTGGAGGACAGAGGGG + Intergenic
1177807204 21:25885950-25885972 TGTGAGCTTGGAGGAGAGGCAGG + Intronic
1177908542 21:27001069-27001091 TGTGCTTTGGGAGGCCAAGGTGG + Intergenic
1177944142 21:27446198-27446220 TGTGCACTGGGAGAACAAGGTGG - Intergenic
1181166454 22:20985922-20985944 TGTGTTCTAGGAGGAAAGGCAGG - Intronic
1181867560 22:25871053-25871075 TGTCCTTTTGGAGGCCAGGCTGG + Intronic
1182416244 22:30223185-30223207 TGGGCTCTTGGAGGGCCAGTTGG + Intergenic
1182714674 22:32348137-32348159 TGAGCTCCTGGAGGACAGGGAGG + Intergenic
1183551122 22:38486233-38486255 TCTGCCTTTGGAGCACAAGCAGG - Exonic
1183557016 22:38536878-38536900 TTTGCTCTTGTTGCACAAGCTGG + Intronic
1183609973 22:38894156-38894178 AGCACTCTGGGAGGACAAGCAGG - Intergenic
1184152130 22:42645416-42645438 TGTGCTCTTGGAGGACAAGCGGG - Intronic
1184173764 22:42774580-42774602 TGTGCTCTTGCGGGGCAAGCAGG + Intergenic
1184354785 22:43971944-43971966 AGTGCTTTGGGAGGACAAGGTGG - Intronic
1184674182 22:46031557-46031579 TTTGCTCTTGTTGCACAAGCTGG - Intergenic
1184986507 22:48139797-48139819 TCAGCTCTTGGAGGCCCAGCTGG - Intergenic
949255136 3:2036737-2036759 TGTGCTTCTGGATGACAAACAGG - Intergenic
949348451 3:3099246-3099268 AGTGCTCTGGGAGGCCAAGGCGG + Intronic
950825766 3:15819028-15819050 AGTGCTTTGGGAGGACAAGGTGG + Intronic
951370896 3:21846457-21846479 TATGGTCTTGGAGTTCAAGCAGG + Intronic
953072648 3:39537300-39537322 TGTGGTCTGGGAGGCCAAGGAGG - Intergenic
954530122 3:51311173-51311195 GCTGCTCTTGCAGGACAAGCTGG - Intronic
956433817 3:69213923-69213945 AGTGCTTTTGGAGGTCAAGATGG - Intronic
959304169 3:104639038-104639060 TATGCTCTTGAAGGACAAGTGGG + Intergenic
959574021 3:107914747-107914769 TGTGCTCTGGGAGGACGGGGTGG + Intergenic
960440981 3:117688731-117688753 AGTGCTCTTGAAGAACAAACAGG + Intergenic
960818417 3:121699096-121699118 AGTGCCCTTGGAGGTCCAGCTGG - Intronic
960964549 3:123095717-123095739 TTTGCTCTTGTAGCCCAAGCTGG - Intronic
962465847 3:135658212-135658234 TGTGCTCTTGAATGACCAGTGGG + Intergenic
963201602 3:142591732-142591754 TGTGATCTCGGAAGCCAAGCAGG - Intergenic
964808448 3:160637272-160637294 TGAGCTCTTGGAGGTCAGGATGG + Intergenic
965755710 3:172024937-172024959 AGTGCTTTGGGAGGACAAGGTGG - Intergenic
966007749 3:175037195-175037217 TGTTGTCCTGGAGGACAAGTGGG - Intronic
966365182 3:179177990-179178012 AGTGCTCTGGGAGGCCAAGGTGG + Intronic
968910440 4:3474572-3474594 TGTGCTTTGGGAGGCCAAGGCGG + Intronic
972423778 4:38913848-38913870 AGCGCTTTTGGAGGCCAAGCTGG + Intronic
972567961 4:40285822-40285844 GGTGCTGACGGAGGACAAGCCGG + Intergenic
974052306 4:56952422-56952444 TGTGCTCTGGCAGGACAAGCGGG + Intergenic
975515803 4:75246695-75246717 AGTGCTTTGGGAGGACAAGGTGG - Intergenic
975707478 4:77125361-77125383 TGTGATGTGGGAGGAAAAGCTGG - Intergenic
976496670 4:85738166-85738188 TGTACTCTGGGAGGCCAAGGTGG - Intronic
978555015 4:109970577-109970599 TGTGCTTTGGGAGGCCAAGGTGG + Intronic
979210071 4:118089950-118089972 TGTGCTCTTTGAGCAAAAGCAGG - Intronic
981455971 4:144953787-144953809 TGTGCACTGGGAGAACAAGGCGG + Intergenic
982390567 4:154858737-154858759 TGAGCTGTTGGAGGACAAGGAGG - Intergenic
982730255 4:158948256-158948278 TGTTATCTAGCAGGACAAGCAGG - Intronic
985645943 5:1084822-1084844 TGTCCTTTTGGAGGAGCAGCTGG - Intronic
986727498 5:10610239-10610261 AGTGCTCTAAGTGGACAAGCTGG - Intronic
990475575 5:56158939-56158961 AGTGCTCTGGGAGGCCAAGGTGG - Intronic
991573321 5:68077878-68077900 TTTGCTCTTGGATGGCCAGCTGG + Intergenic
991670220 5:69039713-69039735 AGTGCTTTGGGAGGACAAGGTGG + Intergenic
992174634 5:74137545-74137567 TGTGCTCCTGTAAGGCAAGCGGG - Intergenic
992711310 5:79460217-79460239 AGTGCTTTGGGAGGCCAAGCTGG + Intronic
992816371 5:80443863-80443885 TGGGCTCTTGGATGCCAGGCTGG - Intronic
992891795 5:81210713-81210735 TGTGCTCTTGTATGACAGGTTGG - Intronic
992914001 5:81429249-81429271 TGTACTCTTAGAGGAAAAGGAGG + Intronic
993152974 5:84184074-84184096 TTTGCTCTTGGAGCCCAGGCTGG - Intronic
995251511 5:109998406-109998428 TTTGCTTTTGCAGGACAAGTAGG + Intergenic
995365461 5:111355043-111355065 TGTGCTCTGGAAGTACAGGCAGG + Intronic
996913924 5:128688630-128688652 AGTGCTTTGGGAGGACAAGGCGG + Intronic
997848794 5:137312649-137312671 TGTGCTCTTTCAGGAGCAGCAGG + Intronic
998379741 5:141715772-141715794 TCTGCTCCTGGAAGAGAAGCTGG + Intergenic
999263133 5:150249882-150249904 TGAGACCTTGGAGGATAAGCAGG - Intronic
1000398055 5:160796795-160796817 CCTGCACTTGGAGGACAAGAAGG + Intronic
1000636053 5:163644969-163644991 TGTGCTTTGGGAGGCCAAGGCGG - Intergenic
1001120107 5:168973065-168973087 TGGGCTCTTCAAGGACAAGCTGG - Intronic
1001120936 5:168979297-168979319 TGTGCACTTGGAGGCCAGACAGG + Intronic
1002405624 5:179027889-179027911 TGGGCTCCTAGAGGACAACCAGG - Intronic
1003188659 6:3854071-3854093 TGTGGTCATGGAGGACCAGGAGG - Intergenic
1003878736 6:10461747-10461769 AGTGCTTTTGGAGGCCAAGGTGG + Intergenic
1004393360 6:15227597-15227619 GGTGCTTTGGGGGGACAAGCGGG + Intergenic
1004662390 6:17721845-17721867 TCTGATCTTGGAGGCTAAGCAGG - Intergenic
1004775591 6:18841055-18841077 CGTGTTCTTGGAAGACAAGATGG - Intergenic
1006395305 6:33783269-33783291 TGAGCACTTGGAGGAGAAACAGG - Intronic
1006674981 6:35756159-35756181 AGTGCTTTGGGAGGACAGGCAGG + Intergenic
1006867747 6:37222643-37222665 TGTGCTCTTGGAGGAGGGCCGGG - Intronic
1007013687 6:38441662-38441684 AGTGCTTTTGGAGGCCAAGGTGG - Intronic
1007093496 6:39199373-39199395 TGTGCCCTTTGGGGACCAGCTGG + Intronic
1008386550 6:50897803-50897825 AGTGCTCTAGGAGGTCATGCAGG - Intergenic
1011656319 6:89555182-89555204 TGTAGACTTAGAGGACAAGCGGG - Intronic
1014023396 6:116616743-116616765 TGAGCCCTTGGAGGCGAAGCAGG + Exonic
1014613468 6:123572994-123573016 TGTGCTCTTTGAAGACAGGGTGG + Intronic
1015498064 6:133901639-133901661 TGTACTCTGGGAGGCCAAGGCGG + Intergenic
1015516216 6:134085111-134085133 TTTGCTCTTGCTGCACAAGCTGG - Intergenic
1016546134 6:145226623-145226645 CCTGCGCTTGGAGGAAAAGCAGG + Intergenic
1017155435 6:151318686-151318708 AGTGCTCTGGGAGGCCAAGGTGG + Intronic
1017327749 6:153159286-153159308 TGTGATCTTGGAAGCTAAGCAGG - Intergenic
1017864502 6:158431468-158431490 TGTGCACATGTAGGACAGGCAGG + Intronic
1019833330 7:3355955-3355977 GGTGAGCGTGGAGGACAAGCTGG - Intronic
1020220937 7:6236455-6236477 AGTGCTTTTGGAGGCCAAGTTGG - Intronic
1020241978 7:6402136-6402158 TGTACTCTTGGGGAACCAGCTGG + Intronic
1021145031 7:17075739-17075761 TGTACTCTTGTAGGTCAAGATGG + Intergenic
1022140180 7:27486956-27486978 TGTGGTCTTGGAGGCCATGGAGG - Intergenic
1023338570 7:39195476-39195498 TGGGGTCTTGGAGGAGAAGAGGG + Intronic
1024437458 7:49376377-49376399 TGTGCACTAGGTGGACAAGATGG + Intergenic
1024638093 7:51307095-51307117 AGTGCTCTGGGAGGCCAAGGCGG + Intronic
1025309871 7:57919893-57919915 TGAGCTCTTTGAGGACTAGGTGG + Intergenic
1026777155 7:73237680-73237702 AGTGCTCTGGGAGGCCAAGGTGG + Intergenic
1026914719 7:74112916-74112938 TGTGCTTTTGGTGGAGAACCGGG - Intronic
1027018001 7:74791052-74791074 AGTGCTCTGGGAGGCCAAGGTGG + Intergenic
1027070025 7:75154860-75154882 AGTGCTCTGGGAGGCCAAGGTGG - Intergenic
1028147184 7:87331020-87331042 TGTGCACTAGGAGGACAGGGTGG - Intergenic
1028824571 7:95255812-95255834 TGTGTTCTTGGAGTAGAAGTGGG + Intronic
1032105599 7:129026430-129026452 TTTGCTCTTGTTGGCCAAGCTGG + Intronic
1032199504 7:129809402-129809424 AGTGCTTTGGGAGGCCAAGCAGG + Intergenic
1034351299 7:150416519-150416541 TGTGTGATTGGAGGACAAGAGGG - Intergenic
1034927620 7:155135127-155135149 GCAGCTCTTGGAGGACGAGCCGG - Intergenic
1035161891 7:156956891-156956913 TGTCCTCTAGGAGGACAGGGAGG - Intronic
1035228584 7:157447058-157447080 AGTGCTTTGGGAGGCCAAGCTGG + Intergenic
1036000525 8:4597824-4597846 TGTGAGTTTGGGGGACAAGCAGG - Intronic
1040842901 8:51803602-51803624 TGTGGTCCTGGAGGAAAAGGAGG - Intronic
1040880671 8:52201210-52201232 TGCGTTCTTGAAGGAAAAGCTGG - Intronic
1041242235 8:55857853-55857875 TGTGTTCTGGGAGGCCAAGGTGG - Intergenic
1042497057 8:69466885-69466907 TTTGCTTTTGGAGGAAAAGGAGG + Exonic
1042867705 8:73370120-73370142 TGTGCTCTTGAAAGTCCAGCAGG + Intergenic
1043200668 8:77365514-77365536 GGAGCTCTTGTAGGGCAAGCTGG - Intergenic
1044456806 8:92399464-92399486 TGTGGTCTAGGAGGACAGGCAGG - Intergenic
1048012505 8:130469554-130469576 TGTGATGGTGGAGGACAGGCTGG + Intergenic
1048175543 8:132149229-132149251 TGTGCACTGGGAGGACAGGGTGG + Intronic
1049268838 8:141683565-141683587 TGTGCTCTGGGAAGCCAACCTGG + Intergenic
1049690943 8:143958620-143958642 AGTGCTCTCCGAGCACAAGCAGG + Intronic
1050240768 9:3632110-3632132 TGTGCTTTGGGAGGCCAAGGTGG - Intergenic
1051371859 9:16365576-16365598 CGTGCACTTGGTGGACCAGCTGG - Intergenic
1051625844 9:19099575-19099597 TGTGCTATGGGAGGGCAAGGTGG - Intronic
1051897496 9:22003916-22003938 CATGATTTTGGAGGACAAGCTGG + Exonic
1051918805 9:22239299-22239321 TGTGGTCCTGGAGGATAAACAGG + Intergenic
1052402960 9:28024257-28024279 TGTGCTCTACAAGGACAACCAGG + Intronic
1052927703 9:34031245-34031267 TTTGCTCTTGTAGCACAGGCTGG - Intronic
1052944017 9:34152988-34153010 CTTGCTCTTGTAGCACAAGCTGG - Intergenic
1052944606 9:34158026-34158048 TGTGCTTTGGGAGGTCAAGGTGG + Intergenic
1054761477 9:69008146-69008168 TGTGCACTTGGAGGGCAGGAGGG + Intronic
1055993185 9:82130021-82130043 AGTGCTTTGGGAGGCCAAGCTGG + Intergenic
1057236950 9:93368681-93368703 AGTGCTTTTGGAGGCCAAGGTGG - Intergenic
1057561745 9:96133238-96133260 TCTGCTCCCTGAGGACAAGCAGG + Intergenic
1058667479 9:107333751-107333773 TGTGCTCGTGGAAGACAATTAGG - Intergenic
1059986927 9:119829484-119829506 TGTGTGCTTGGAGGAGAGGCAGG - Intergenic
1060017231 9:120097420-120097442 TGAGCTCTTGCAAGACCAGCAGG - Intergenic
1060470467 9:123943853-123943875 AGTGCTCTTGGAGACCAAGGCGG + Intergenic
1060965449 9:127710023-127710045 TGTGCTTTAGGAGGCCAAGGCGG + Intronic
1061970047 9:134039999-134040021 TGGGCTCTTGGAGCCCGAGCAGG + Intronic
1062644799 9:137542219-137542241 AGTGCTCTGAGAGGACAAGATGG + Intronic
1185469561 X:374275-374297 TGTGCTCTGGAGGGGCAAGCCGG - Intronic
1186133881 X:6498082-6498104 TGTGCTTTGGGAGGTCAAGCAGG - Intergenic
1186504877 X:10083237-10083259 TGTGCTCCTGGAAGAGAGGCGGG + Intronic
1186531401 X:10299357-10299379 TGTGTCCATGGAGCACAAGCAGG - Intergenic
1187515165 X:19962835-19962857 AGTGCTCTGGGAGGCCAAGGAGG + Intronic
1188506027 X:30885845-30885867 CGTGCTCTAGGAGGTCAAGAGGG - Intronic
1189242497 X:39536443-39536465 TGTGCTGATGGAGGGGAAGCGGG - Intergenic
1193240820 X:79167032-79167054 AGTGGCCTTGGAGGACAGGCAGG + Intergenic
1193388945 X:80904649-80904671 TGTACTCTGGGAGGTCAAGGTGG + Intergenic
1193730250 X:85094494-85094516 TGTGCTTTGGGAGGCCAAGGCGG + Intronic
1195705251 X:107733775-107733797 TGTGTTTTTGGAGCACATGCTGG - Intronic
1196659749 X:118257363-118257385 AGTGCTTTTGGAGGCCAAGGTGG - Intergenic
1198058779 X:133022404-133022426 TGTGCTTTGGGAGGCCAAGGTGG + Intergenic
1198733607 X:139761575-139761597 AGTGCTTTTGGAGGCCAAGGCGG - Intronic
1202018282 Y:20434995-20435017 TCTCCACTTGGAGGACAAGTGGG - Intergenic