ID: 1184152286

View in Genome Browser
Species Human (GRCh38)
Location 22:42646135-42646157
Sequence CCAAGTAAACAGAAGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 305}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184152274_1184152286 3 Left 1184152274 22:42646109-42646131 CCACCCCAACCCTCACCAGCAGT 0: 1
1: 1
2: 6
3: 58
4: 603
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1184152271_1184152286 21 Left 1184152271 22:42646091-42646113 CCGTCCTCGTCCACAGCACCACC 0: 1
1: 0
2: 3
3: 25
4: 389
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1184152270_1184152286 22 Left 1184152270 22:42646090-42646112 CCCGTCCTCGTCCACAGCACCAC 0: 1
1: 0
2: 0
3: 13
4: 183
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1184152272_1184152286 17 Left 1184152272 22:42646095-42646117 CCTCGTCCACAGCACCACCCCAA 0: 1
1: 0
2: 0
3: 22
4: 259
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1184152281_1184152286 -7 Left 1184152281 22:42646119-42646141 CCTCACCAGCAGTGGGCCAAGTA 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1184152273_1184152286 11 Left 1184152273 22:42646101-42646123 CCACAGCACCACCCCAACCCTCA 0: 1
1: 0
2: 8
3: 134
4: 1165
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1184152278_1184152286 -1 Left 1184152278 22:42646113-42646135 CCCAACCCTCACCAGCAGTGGGC No data
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1184152276_1184152286 0 Left 1184152276 22:42646112-42646134 CCCCAACCCTCACCAGCAGTGGG 0: 1
1: 0
2: 1
3: 24
4: 338
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1184152269_1184152286 23 Left 1184152269 22:42646089-42646111 CCCCGTCCTCGTCCACAGCACCA 0: 1
1: 0
2: 0
3: 18
4: 232
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1184152280_1184152286 -6 Left 1184152280 22:42646118-42646140 CCCTCACCAGCAGTGGGCCAAGT 0: 1
1: 1
2: 3
3: 13
4: 127
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1184152279_1184152286 -2 Left 1184152279 22:42646114-42646136 CCAACCCTCACCAGCAGTGGGCC 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184152286 Original CRISPR CCAAGTAAACAGAAGGCAGG TGG Intronic
902076148 1:13788197-13788219 ACAAGTGAACAGACGCCAGGTGG - Intronic
906135822 1:43500155-43500177 GAAAGTGAAGAGAAGGCAGGAGG - Intergenic
906548343 1:46638749-46638771 CCAAGAGAATAAAAGGCAGGGGG - Intronic
906924692 1:50102467-50102489 CCATGGAAAAAGAAGGGAGGAGG - Intronic
906984099 1:50664495-50664517 ACAACTAAACAGAAGGCTGGGGG + Intronic
907350804 1:53829191-53829213 CAAAGTAAAGAGATGGCAGGAGG + Intronic
907602309 1:55783777-55783799 CCAATTAAGCTAAAGGCAGGAGG - Intergenic
909531375 1:76685328-76685350 ACAAGGTCACAGAAGGCAGGAGG - Intergenic
909901194 1:81137799-81137821 CTAAGTAGACAGACAGCAGGTGG + Intergenic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
910615542 1:89193950-89193972 ACAAATAAAAAGAAGGGAGGGGG + Intronic
915340475 1:155174374-155174396 CCAAGAAAACTGAGGACAGGTGG + Intronic
916292760 1:163184649-163184671 CCTTGTAAGAAGAAGGCAGGAGG + Intronic
917517291 1:175718745-175718767 TCATGTAAACAGAAGCCCGGGGG + Intronic
917980088 1:180263778-180263800 CCCACTAAAAAGCAGGCAGGGGG - Intronic
919704567 1:200664209-200664231 TGCAGTAAGCAGAAGGCAGGAGG - Intronic
919724791 1:200874448-200874470 CCAAGTAGACAGAAGGGAAGTGG + Intergenic
922198517 1:223381244-223381266 CAAAGTAACCAGAAGCCAGATGG + Intergenic
922515038 1:226201250-226201272 CCAAGCAAAGAGATGGGAGGAGG - Intergenic
922849940 1:228723845-228723867 CCTAGTGAACCTAAGGCAGGAGG - Intergenic
922912326 1:229228196-229228218 TACAGTAAACAAAAGGCAGGTGG + Intergenic
1063370207 10:5516306-5516328 CTAAGTAAACAGAGCACAGGAGG - Intergenic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1065853871 10:29814149-29814171 CCAAGTACACAGAGGGAAGGAGG - Intergenic
1068899549 10:62251484-62251506 CCAAGTGATTAGAAGTCAGGTGG - Intronic
1069374499 10:67780312-67780334 CCTAGTAAAGAGATGGCTGGGGG + Intergenic
1069664319 10:70144894-70144916 CTACGTAATCAGAAGGTAGGGGG - Intronic
1069760784 10:70809595-70809617 CCAAGTAACCACAAGACAGAGGG + Intergenic
1070458442 10:76641546-76641568 CCCATCAAACAGAAGACAGGAGG - Intergenic
1070704705 10:78629228-78629250 GCCAGCAAGCAGAAGGCAGGAGG - Intergenic
1070721134 10:78757988-78758010 CCAAGAACACAGGAGGCAGGAGG + Intergenic
1071049402 10:81428209-81428231 GCAAAAAAAGAGAAGGCAGGAGG - Intergenic
1071524952 10:86353195-86353217 CAAAGGAAACACAAGGCAAGGGG + Intronic
1072627341 10:97121301-97121323 CCAAGTCTGCAGAAGGGAGGGGG - Intronic
1072634082 10:97166010-97166032 CCAAGGAGACAGATGGCAGAGGG - Intronic
1074843511 10:117376563-117376585 CTAAGTAGTCAGAGGGCAGGAGG - Intergenic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1075812654 10:125236572-125236594 CCACGTAGGGAGAAGGCAGGAGG + Intergenic
1075980733 10:126736993-126737015 CCAGGTCAGCAGCAGGCAGGAGG - Intergenic
1076681234 10:132172510-132172532 CCAATGAAATAGAAGGAAGGGGG - Intronic
1078142525 11:8702534-8702556 GCAAGAAAGCAGAAGGGAGGGGG - Intronic
1078943042 11:16030898-16030920 CCAATGAAACAGGAGGCAGGAGG + Intronic
1079080668 11:17411600-17411622 TCAATTAAACAGAAGGAAAGAGG - Intronic
1081469884 11:43359488-43359510 CCGAGGAAATAGAAAGCAGGTGG + Intronic
1081570245 11:44286273-44286295 CTGAGCAAACAGAAGGCAAGAGG - Intronic
1082789053 11:57335021-57335043 ACAAGTAGAGAGAAGGAAGGAGG - Intronic
1084341134 11:68502475-68502497 CCAAGTAAACAGTGGGTTGGAGG + Intronic
1084617737 11:70247626-70247648 TGAAAAAAACAGAAGGCAGGGGG - Intergenic
1084666045 11:70576894-70576916 ACAAGGACACAGCAGGCAGGTGG + Intronic
1085000002 11:73024479-73024501 ACATGTAAACAGATGGCAGAGGG + Intronic
1086046281 11:82535614-82535636 ACAAGTAAACAGAAGGTAACAGG + Intergenic
1086135359 11:83438819-83438841 CCAAGGCTACAGAAGGCAGAGGG - Intergenic
1086919797 11:92573382-92573404 CCAATAAAACAGAAAGCAGAGGG - Intronic
1091186452 11:133651989-133652011 ACAAGAAAGCAGAAGGCAGCAGG + Intergenic
1091302173 11:134514724-134514746 CCAACTACACAGAGGGCTGGGGG + Intergenic
1092177178 12:6417962-6417984 ACAGGTAAAAAGAGGGCAGGAGG + Intergenic
1093388924 12:18593389-18593411 CCAAGAAAATAAAAGGCAGATGG - Intronic
1093893548 12:24551985-24552007 CTAAGTAGACAGAAGACAAGAGG - Intergenic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096240744 12:49958926-49958948 CCAAGGTACCAGAAGACAGGCGG + Intergenic
1096541323 12:52308843-52308865 CAAAAAAAACAGAAGGCAGGCGG - Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097218995 12:57435774-57435796 CCAGCTACTCAGAAGGCAGGAGG + Intronic
1097589706 12:61559452-61559474 CCCAGTTGATAGAAGGCAGGAGG - Intergenic
1097674525 12:62584401-62584423 CCAAGGAAAAATAAGGCATGAGG + Intronic
1097861147 12:64519948-64519970 TCACGTACACAGAAGGCAGGGGG - Intergenic
1100783382 12:98053409-98053431 CTAAGTAAATAGAAGCCAGTTGG - Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101313329 12:103604858-103604880 CCAAGCAAGCAGAAGATAGGAGG - Intronic
1101358139 12:104000038-104000060 CCAAGAAAACAGAAGGGGAGAGG - Intronic
1101802636 12:108035570-108035592 CAAAGCACACAGAAGACAGGAGG + Intergenic
1101946721 12:109142984-109143006 CCCAGCAAACAGCTGGCAGGAGG + Intronic
1104272805 12:127297389-127297411 AATAGTAAACAGAAAGCAGGGGG + Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105211483 13:18259567-18259589 CCAAGCAGGCAGAGGGCAGGTGG - Intergenic
1105663041 13:22520618-22520640 GCAATATAACAGAAGGCAGGAGG + Intergenic
1105742197 13:23338407-23338429 GCAAGTACACAGAAGCCACGTGG + Exonic
1108363094 13:49685576-49685598 TCAAGAAAACTGAAGGCAGCTGG + Intronic
1108507987 13:51129907-51129929 CCAAGGACATAGAAGACAGGAGG - Intergenic
1108879267 13:55089363-55089385 CCAAGGAAGCAAGAGGCAGGGGG - Intergenic
1110981207 13:81900921-81900943 CCAATTAAACAGATGAAAGGTGG + Intergenic
1111802941 13:93002526-93002548 CCACGTAAACTAAATGCAGGAGG - Intergenic
1112643928 13:101307671-101307693 CCAAGAAAAGGGAAGGGAGGAGG + Intronic
1114647608 14:24264273-24264295 ACAAGGAAACAGAATCCAGGAGG + Intronic
1115556505 14:34548593-34548615 AAAACAAAACAGAAGGCAGGAGG + Intergenic
1115648285 14:35385128-35385150 CGAAGTGAACAAAAGTCAGGAGG - Intergenic
1116030517 14:39565575-39565597 CCTAGAAAACAGAAGGCAGATGG - Intergenic
1116424103 14:44768381-44768403 CCACTGAAACAAAAGGCAGGAGG + Intergenic
1116462893 14:45198052-45198074 CAAATTAAAAAGAAGGCTGGTGG - Intronic
1116464201 14:45213015-45213037 CCAAGGAAACATAAGGCAGAAGG - Intronic
1116631733 14:47344107-47344129 CCAAGAATAAAGAAGGCAGAAGG - Intronic
1119933126 14:78567005-78567027 CCAGGTAAAGAGGAGCCAGGAGG - Intronic
1120811897 14:88812416-88812438 CCAAGGAAACAGGTTGCAGGGGG + Intergenic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121382974 14:93490237-93490259 CCATCTCAACAGAAGCCAGGAGG - Intronic
1125238564 15:37546775-37546797 CCAAGTAAACAAAAAGCAATAGG + Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1126258133 15:46652461-46652483 CCCATTAAACAGAAGGCCAGGGG + Intergenic
1126431708 15:48592587-48592609 CCAAGCAAAGAGAAGGCAAAGGG + Intronic
1127427221 15:58868164-58868186 CCAAAGAAACAGATGGCATGAGG - Intronic
1127517775 15:59713151-59713173 AAAAGCAAACACAAGGCAGGAGG - Intergenic
1129170512 15:73804614-73804636 CCAAGCAATTAGAAGGCAGAGGG - Intergenic
1130957255 15:88636448-88636470 TGAACTAAACAGATGGCAGGGGG + Intronic
1131260269 15:90884299-90884321 CCACGGAAACGGAAGGGAGGAGG - Intronic
1131315314 15:91330516-91330538 TTAAGTAAACAGATGGCAGATGG - Intergenic
1131967352 15:97858539-97858561 CTGACAAAACAGAAGGCAGGAGG + Intergenic
1132063663 15:98713058-98713080 CCAAGGACACAGCAGGCAGGCGG - Intronic
1132100215 15:99017701-99017723 GTATGTAAACAGAAGGGAGGAGG - Intergenic
1132631770 16:921206-921228 CCAGGTAAGTAGAAGGCAGGAGG + Intronic
1134890872 16:17840887-17840909 CCAAGAAAAAAGCAAGCAGGTGG + Intergenic
1137476212 16:48811640-48811662 TCAAGTAAACAGAAAGGAGAAGG - Intergenic
1137484740 16:48881845-48881867 CCAAGGTATCAGAAGGCTGGTGG - Intergenic
1137810434 16:51347350-51347372 CCAAAAAAACAAAAGGCAGCAGG - Intergenic
1138366795 16:56485923-56485945 CCAAATAAACAGAAGACAAGTGG + Intronic
1139255831 16:65541569-65541591 TTAAGTAAATAGATGGCAGGTGG - Intergenic
1139466734 16:67158061-67158083 TCATGTAAACAGATGGCAGCTGG - Intronic
1139469220 16:67169537-67169559 CTAACTGAGCAGAAGGCAGGCGG + Intronic
1141159420 16:81619172-81619194 CCAAGTGCAAAGCAGGCAGGAGG - Intronic
1143666543 17:8365322-8365344 CCAAGTAACTAGGAGGGAGGAGG + Intergenic
1144536716 17:16097219-16097241 CCAAAAAACCACAAGGCAGGAGG + Intronic
1147332204 17:39705701-39705723 CCCAGCAATCTGAAGGCAGGGGG + Intronic
1147976981 17:44253426-44253448 CCAAGTATGGAGAAGGAAGGAGG - Intronic
1148846749 17:50534150-50534172 CCAAGCACAGAGAAGGGAGGAGG - Intronic
1150225774 17:63523719-63523741 CCAAGGAAACAGCTGGCAGTAGG - Intronic
1150333573 17:64313882-64313904 CAAGGTCCACAGAAGGCAGGTGG + Intergenic
1150933002 17:69605435-69605457 CCAAGTCTACAGGAGGCAGCAGG + Intergenic
1151258453 17:72898080-72898102 CCAAGTGAACTGAATGCAGCAGG + Intronic
1151419162 17:73986004-73986026 CCAAGTCAACCAAAGGCTGGAGG - Intergenic
1151837312 17:76590877-76590899 CTAAGTAAACAGAAAGTAAGAGG - Intergenic
1152121012 17:78418360-78418382 CGCTGTACACAGAAGGCAGGCGG - Intronic
1156221806 18:35060238-35060260 GAAAGTAAACAGAAGGCATATGG + Intronic
1158702747 18:59763521-59763543 CCAAGTAAACAGGATCCAGAAGG - Intergenic
1160050153 18:75425932-75425954 CCAGGTACACAGTAGGCATGAGG - Intronic
1162753956 19:12846085-12846107 CCAGCTACACAGAAGGCAGAGGG + Intronic
1165164974 19:33846407-33846429 GCAAGTATACAGAGAGCAGGAGG + Intergenic
1166866869 19:45843985-45844007 GCCAGTGAAGAGAAGGCAGGGGG + Intronic
1167489117 19:49781687-49781709 CCTAGGAAAGAGAGGGCAGGTGG + Intronic
925982442 2:9188081-9188103 CCAAGCATACACAAGGTAGGAGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926998608 2:18768419-18768441 CAAAGTAGCCAGAAGGTAGGGGG - Intergenic
927212141 2:20645509-20645531 CCAGGGGAAAAGAAGGCAGGTGG + Intronic
928233653 2:29521634-29521656 CCAAGTAATGAGAAAGAAGGAGG + Intronic
929361522 2:41097626-41097648 CTAATTAAAATGAAGGCAGGAGG + Intergenic
930114653 2:47708155-47708177 CCAGGAAAAAAGAAGGCAAGAGG - Intronic
930538371 2:52672270-52672292 CCACTGAAACAGAAGACAGGAGG + Intergenic
930924231 2:56796988-56797010 GGAAGGAAACAGAAGGCATGAGG - Intergenic
931431533 2:62212551-62212573 TCAAGCAGACAGAAGGAAGGAGG - Intronic
931867050 2:66424987-66425009 TCAGGGAAACACAAGGCAGGAGG - Intergenic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
934161278 2:89252122-89252144 ATAAGTAAACAGAAGGCTTGAGG + Intergenic
934206001 2:89930293-89930315 ATAAGTAAACAGAAGGCTTGAGG - Intergenic
934658609 2:96131165-96131187 CCAAGTTAAATGAAAGCAGGAGG - Intronic
935640506 2:105285543-105285565 CCAGGTACACAGCAGGCAGCTGG + Intronic
936769952 2:115900112-115900134 AAAAGTGAACAAAAGGCAGGAGG - Intergenic
936855953 2:116957492-116957514 CCTAATAAACAGAAATCAGGAGG - Intergenic
937184605 2:120028418-120028440 CCAACTATTCAGAAGGCTGGAGG + Intronic
937899802 2:127011247-127011269 CCTAGTGCAGAGAAGGCAGGGGG - Intergenic
938752818 2:134350632-134350654 CCAAGTAAACAGAAAGCAGCAGG - Intronic
938861802 2:135377113-135377135 TTAAGTAAACAGATGGCAGATGG + Intronic
939970585 2:148654727-148654749 GCCAGAAAACAGAAGGAAGGAGG - Intronic
940032892 2:149283531-149283553 CCCAGTAAAGAGAATGGAGGTGG + Intergenic
941001082 2:160204564-160204586 CAACGTAAAGAAAAGGCAGGGGG + Intronic
941016546 2:160363852-160363874 CCAAGAAAACAGAAACCAGAAGG + Intronic
942081503 2:172403490-172403512 TGAAGTAAACAGAAGGAAGCTGG + Intergenic
942098889 2:172558645-172558667 ATAAGGAAACAGAAGGCAAGAGG - Intronic
943690412 2:190864036-190864058 ACAAGTAAACAGAAAGCAGGTGG - Intergenic
945174952 2:207034423-207034445 CCAAATAAACATATGGAAGGTGG + Intergenic
945500808 2:210572129-210572151 CAAAGTAATCAGCAGTCAGGGGG - Intronic
1169020638 20:2328351-2328373 ACAAGTACCCAGAAGGTAGGAGG + Exonic
1169165158 20:3416280-3416302 ATAAGAAAACAGAAGCCAGGCGG - Intergenic
1169677377 20:8169190-8169212 CAAAGTAAAGAGATGGCAGTAGG - Intronic
1169678895 20:8187196-8187218 CAAAGTACACAGAAGGCAATTGG - Intronic
1170005826 20:11667928-11667950 CCAATTAAAAAGAAAGCTGGAGG - Intergenic
1171152880 20:22843192-22843214 TCAAGGAAACAGAAGGAAGAGGG + Intergenic
1172792941 20:37518868-37518890 CCAAGGAAGCAGAAGACGGGAGG - Exonic
1173243854 20:41320624-41320646 CCAATAAAACAGAGGTCAGGTGG - Intergenic
1176195764 20:63835856-63835878 CCCAGCAGACAGAAGGCAAGGGG + Intergenic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1177746022 21:25214141-25214163 CCAAGGACAAAAAAGGCAGGAGG - Intergenic
1177807690 21:25890168-25890190 CCAAGAGAACAGCAGGCAGCAGG - Intronic
1178711081 21:34917273-34917295 CCAAGGAAAGAGAAAGCAGATGG + Intronic
1178785451 21:35649260-35649282 CCAGGAAAAGAGAAGGCAGGAGG - Intronic
1180764742 22:18339871-18339893 CCAAGCAGGCAGAGGGCAGGTGG + Intergenic
1180782920 22:18530874-18530896 CCAAATAAACAGAAGGAAAGGGG - Intergenic
1180814287 22:18779813-18779835 CCAAGCAGGCAGAGGGCAGGTGG - Intergenic
1180910826 22:19448739-19448761 GCAAGTAAAGAGGAGGCTGGTGG + Intergenic
1181200473 22:21214148-21214170 CCAAGCAGGCAGAGGGCAGGTGG - Intronic
1181239818 22:21470236-21470258 CCAAATAAACAGAAGGAAAGGGG - Intergenic
1181283070 22:21733611-21733633 CCAGCTACTCAGAAGGCAGGTGG + Intronic
1182012818 22:27014782-27014804 CCAAATAAAGAGAAGACAGCAGG - Intergenic
1182905357 22:33931160-33931182 ACAAGTAAACAGAAGTAAGAAGG - Intergenic
1182972535 22:34591248-34591270 CCAAGTAACCAGTAGGCTGTAGG + Intergenic
1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG + Intronic
1185216103 22:49600797-49600819 TCCAGTAGACAGGAGGCAGGAGG + Intronic
1203226365 22_KI270731v1_random:80776-80798 CCAAGCAGGCAGAGGGCAGGTGG + Intergenic
1203264386 22_KI270734v1_random:5500-5522 CCAAGCAGGCAGAGGGCAGGTGG - Intergenic
951844778 3:27073500-27073522 CCAGGAAAGGAGAAGGCAGGTGG + Intergenic
952756479 3:36872813-36872835 CTAAGAAAACAGAATGCAAGGGG + Intronic
953357936 3:42270206-42270228 CCCACTTACCAGAAGGCAGGAGG + Intergenic
953583847 3:44181701-44181723 CACAGGAAAGAGAAGGCAGGGGG + Intergenic
954869793 3:53759068-53759090 TCTAGGAAGCAGAAGGCAGGTGG - Intronic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
959532318 3:107447664-107447686 CCTAATAACCAGAAGGTAGGAGG + Intergenic
959918617 3:111846485-111846507 TCAAGTAACCAGAAGGCTGAGGG + Intronic
961666401 3:128495811-128495833 CCCAGTAGGCAGGAGGCAGGTGG - Intergenic
962368205 3:134799701-134799723 ACAAGTCAATAGAAGGCAGAAGG - Intronic
966942685 3:184756908-184756930 CCAAGGAAACAGAGGCCAGGAGG + Intergenic
967419839 3:189260782-189260804 CTAAGTCAACAGGAGGCAGATGG - Intronic
968698674 4:2044596-2044618 CCAGGTGAACAGCAGGCTGGAGG + Intergenic
968982745 4:3859430-3859452 CCAAGTATACAGCAGGCACCAGG - Intergenic
969150027 4:5161377-5161399 ACAAGAAATCTGAAGGCAGGTGG + Intronic
969284437 4:6194097-6194119 CCAAGGAGACAGAGGGCAGATGG + Intronic
971017440 4:22503076-22503098 GCAAGCAAACAGGAGGTAGGAGG + Intronic
972901351 4:43687947-43687969 CAAACAAAACAGAAGACAGGTGG + Intergenic
973695941 4:53491404-53491426 CCAAGTCAGCATTAGGCAGGTGG - Intronic
974407177 4:61488650-61488672 GGAAGTAAACAAAAGTCAGGAGG - Intronic
975395696 4:73870529-73870551 CCAACTGACCAGAAGGGAGGAGG + Exonic
975415170 4:74097741-74097763 CCAACTGACCAGAAGGAAGGAGG - Exonic
976536211 4:86221195-86221217 CAAACTAAACAGAAGTGAGGAGG + Intronic
976806470 4:89052636-89052658 CCATGTCAACAGAAGCCAGGAGG - Intronic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977232013 4:94462850-94462872 CCCTGTAAAAAGAAGACAGGTGG - Intronic
978913019 4:114087729-114087751 CCAAGCAAACATATGGCAGTGGG + Intergenic
979369954 4:119873053-119873075 CCAAGTAAGCACAAGTAAGGTGG + Intergenic
980461961 4:133126056-133126078 CCTAGTAAACAGAAGAGGGGAGG + Intergenic
981512112 4:145568731-145568753 CCAAGTAAACAGAAAAAAAGTGG + Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982185445 4:152792668-152792690 CCCAGGAAAGAGAGGGCAGGAGG - Intronic
983090629 4:163497668-163497690 CCATGTAAGAGGAAGGCAGGAGG - Intronic
983374327 4:166904834-166904856 CCAAGGAAAAAGAATACAGGAGG - Intronic
984878990 4:184393880-184393902 CCAAGGAAACAGAGGACACGGGG - Intronic
985726640 5:1519764-1519786 CCAGGTCATCAGAAGGCAGCTGG + Intronic
988657966 5:33233444-33233466 AGAGGAAAACAGAAGGCAGGTGG + Intergenic
991107774 5:62862692-62862714 CCAAGCCTGCAGAAGGCAGGGGG + Intergenic
992847340 5:80764463-80764485 CCAACTACTCAGAAGGCTGGAGG - Intronic
993046697 5:82874364-82874386 CAAAGAATACAGAAGGCAGGTGG + Intergenic
993476874 5:88377147-88377169 CCCAGAAAACATAGGGCAGGTGG - Intergenic
994587653 5:101730354-101730376 ACAAGTAAACAGAAGACATCTGG + Intergenic
995042899 5:107609403-107609425 CCAAGTCACGGGAAGGCAGGAGG - Intronic
995934017 5:117486444-117486466 GCAAGAAATCAGAGGGCAGGAGG + Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
997432622 5:133851245-133851267 CCAGGGAACCAGAAGACAGGGGG + Intergenic
997523863 5:134540135-134540157 CCAAGGAAGCAAAAGGCAGGTGG + Intronic
998739680 5:145186351-145186373 CCACTGAAACAAAAGGCAGGAGG - Intergenic
998964746 5:147527097-147527119 CAAAGGAAACAGAAAGCAGTAGG - Intergenic
999648841 5:153746079-153746101 ACAAGTTAACAAATGGCAGGGGG + Intronic
1000559970 5:162774596-162774618 CCAAGTAAACCCAAAGCAGAAGG - Intergenic
1000972397 5:167728493-167728515 CCAACTACTCAGGAGGCAGGAGG + Intronic
1002259173 5:177982256-177982278 CCAAGGAAGCAGCAGCCAGGAGG + Intergenic
1003084300 6:3049260-3049282 CAAAGTAGGCAGAAGGGAGGGGG - Intergenic
1003954546 6:11149678-11149700 CCCAGGAAACAGAAGAAAGGTGG - Intergenic
1005275511 6:24212409-24212431 GAAAGAAAACAAAAGGCAGGAGG - Intronic
1006809019 6:36807932-36807954 GGAAGGAAACAAAAGGCAGGAGG + Intronic
1008690259 6:53971073-53971095 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1011105054 6:83770126-83770148 CCAAGCAAACAGAAGCCTAGGGG - Intergenic
1011597125 6:89026602-89026624 CCTTGTAAAAGGAAGGCAGGAGG + Intergenic
1011704714 6:89989501-89989523 CCACCTAAGCAGAAGGGAGGTGG - Intronic
1011733683 6:90292437-90292459 ACAACTAAATAGAGGGCAGGTGG + Intronic
1011771914 6:90682786-90682808 CCAGGTAAGGAGAAGGCAGCTGG + Intergenic
1011790971 6:90898243-90898265 TCAAGTTGACAGAAGTCAGGAGG + Intergenic
1013707004 6:112848271-112848293 ATAAGTAAATAGATGGCAGGTGG - Intergenic
1013952518 6:115801547-115801569 CTAAGTAAATAGAAGGCAAATGG + Intergenic
1014406661 6:121060938-121060960 GCAAATAAAGAGAAGGTAGGTGG + Intergenic
1014745120 6:125191791-125191813 CCCAATGAACAGAAGGGAGGGGG - Intronic
1015005883 6:128281256-128281278 CCAAATAAAGCGAAGGCAGGAGG + Intronic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1016007079 6:139100088-139100110 TGAAGTAAACACATGGCAGGTGG - Intergenic
1017111797 6:150939642-150939664 CGCAGTAGAGAGAAGGCAGGTGG - Intronic
1019311946 7:366989-367011 CCAAGGAAACAGTCGGCAGAGGG + Intergenic
1019772326 7:2891479-2891501 CCACGTAAAGAGGAGGGAGGCGG - Intergenic
1020016128 7:4833186-4833208 CCAGGGAAACTGAAGCCAGGGGG - Intronic
1021777922 7:24072261-24072283 CCAGCTAAACAGAGGGCAGGAGG - Intergenic
1021911904 7:25394088-25394110 CCAAGGAAAGAAAAGTCAGGAGG - Intergenic
1023461983 7:40408408-40408430 CTAAGTAAGCAGAAAGCGGGAGG - Intronic
1023475983 7:40578391-40578413 CCCATTAAATAGAAGGCAAGGGG - Intronic
1024708221 7:51985110-51985132 CCAAGAAAGCAGAAGGAAAGAGG + Intergenic
1024818856 7:53303591-53303613 ACAAATAGACAGAAGGAAGGTGG + Intergenic
1025732143 7:64116483-64116505 CCAAGTCTACAGCAGGCAGAAGG + Intronic
1026673932 7:72413944-72413966 TCATGGAAACAGAAGGAAGGGGG - Intronic
1027249393 7:76389627-76389649 CCAAGAAGAGGGAAGGCAGGAGG - Exonic
1027338384 7:77178994-77179016 GCAAATAAACAGAAGGGAGCAGG + Intronic
1029777344 7:102691808-102691830 GCAAATAAACAGAAGGGAGTAGG - Intergenic
1029913042 7:104175119-104175141 CCAAGGAAGCACAAGGCAGAAGG - Intronic
1031070302 7:117154528-117154550 TCAAGTAAACAAAAGTCAGCAGG - Intronic
1032380619 7:131476026-131476048 CCATGTTAACAGAATGAAGGAGG + Intronic
1032537736 7:132678479-132678501 CCAAGCACTGAGAAGGCAGGAGG + Intronic
1032803332 7:135333957-135333979 CAAAGTCATCAGAAGGCAGAAGG + Intergenic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1035482002 7:159194369-159194391 CCAAGTAAACAGAAAGAGGTCGG + Intergenic
1036466990 8:9007711-9007733 CTAAGTAAAAAGAAGACTGGTGG - Intronic
1036496682 8:9276618-9276640 ACAAGGAAGCAGCAGGCAGGTGG - Intergenic
1040963283 8:53058250-53058272 CTAAGTAAAAAGAAGGAAGCTGG + Intergenic
1041180219 8:55239555-55239577 TCAATTCAACAGAAGCCAGGTGG - Intronic
1041559445 8:59198412-59198434 TTAAGTAAACAGATGGCAGATGG + Intergenic
1041847923 8:62352982-62353004 TCAAGTAACAAGAAGGCAGATGG - Intronic
1041967113 8:63691332-63691354 CCAAGTAAACTGAAAGAAGGGGG - Intergenic
1042376085 8:68054820-68054842 CCAAGTAACCAGGAGTCCGGTGG - Intronic
1043368799 8:79566526-79566548 CCAAGTAAAGAAATGGCAGGAGG + Intergenic
1043383020 8:79723102-79723124 CCCAGCAGACAGGAGGCAGGGGG + Intergenic
1044062747 8:87659738-87659760 CCAACTAAAGAGAAGGCGAGGGG + Intergenic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044180571 8:89188713-89188735 CCAAGTAAAGAGTTGGAAGGAGG + Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1046596790 8:116270835-116270857 CCAAGCAAACAGAAAAAAGGAGG - Intergenic
1047136331 8:122082802-122082824 CTGAGTACACAGTAGGCAGGGGG - Intergenic
1047754954 8:127911410-127911432 CCAGGTAAACAGCTGGCAGCCGG - Intergenic
1048522411 8:135169109-135169131 CCAAGCAAACAGCTGGCTGGAGG - Intergenic
1048554952 8:135466660-135466682 GTCAGTAAACAGAAGGCAAGAGG - Intronic
1048803624 8:138218647-138218669 CCATGTAAAAAGAAAGGAGGAGG - Intronic
1051846803 9:21460527-21460549 CTAAATAAACAGAATGAAGGGGG - Intergenic
1053443222 9:38132485-38132507 GCAGGTAAAGTGAAGGCAGGAGG - Intergenic
1055762951 9:79629150-79629172 CCAATCACACATAAGGCAGGAGG - Intronic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1056620358 9:88207288-88207310 AGAAGTAAACAGAAGGCTGTGGG + Intergenic
1057700406 9:97359932-97359954 CCAAGGAAGCAGACTGCAGGAGG - Intronic
1057930131 9:99185812-99185834 CCAGCTACTCAGAAGGCAGGAGG - Intergenic
1059363216 9:113764355-113764377 CCAAGTCAACAGAAGACAATAGG - Intergenic
1060308773 9:122440394-122440416 CCACGGAAACAAAGGGCAGGAGG - Intergenic
1061440700 9:130601448-130601470 CCCACTACACAGAATGCAGGGGG - Intronic
1062556898 9:137117122-137117144 CAAAGTATAGAGAAGGCAGTGGG - Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1186826046 X:13340979-13341001 TCAAGGAAACAGAAGGCCTGGGG + Intergenic
1187340554 X:18417336-18417358 CCAAGTTTAGAGAAGGCAGTTGG - Intergenic
1187569066 X:20482716-20482738 CCAAGTTAACAGCAGTCATGGGG + Intergenic
1191755536 X:64588524-64588546 CCTTATAAAAAGAAGGCAGGAGG - Intergenic
1192059086 X:67804700-67804722 ACAAGTAAGCAGAAGCCAGGAGG + Intergenic
1192753531 X:74020280-74020302 CCAAGCAAACAGAAAAAAGGAGG + Intergenic
1193038310 X:76977589-76977611 CCAACTAACCAGGAGCCAGGAGG - Intergenic
1193847790 X:86496560-86496582 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1193993576 X:88339437-88339459 CCAAGAAGACATAAGGCAGAAGG - Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195620178 X:106945128-106945150 CCCAATAAACATGAGGCAGGTGG + Intronic
1201566747 Y:15373162-15373184 CTAAGTAAAAAGAAGGAAGCTGG + Intergenic