ID: 1184153003

View in Genome Browser
Species Human (GRCh38)
Location 22:42649309-42649331
Sequence GCGGCGCGGGGCCACCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184153003_1184153015 24 Left 1184153003 22:42649309-42649331 CCCCCATGGTGGCCCCGCGCCGC 0: 1
1: 1
2: 2
3: 12
4: 136
Right 1184153015 22:42649356-42649378 GCCGCCGAGACCGTCGCGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 56
1184153003_1184153017 25 Left 1184153003 22:42649309-42649331 CCCCCATGGTGGCCCCGCGCCGC 0: 1
1: 1
2: 2
3: 12
4: 136
Right 1184153017 22:42649357-42649379 CCGCCGAGACCGTCGCGCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184153003 Original CRISPR GCGGCGCGGGGCCACCATGG GGG (reversed) Intronic
900130412 1:1084929-1084951 CCATCGCGGGGGCACCATGGAGG - Intronic
900191887 1:1355567-1355589 GCCGCGCGGGGCCACCCCCGGGG + Exonic
900801519 1:4739946-4739968 ACGGGGAGTGGCCACCATGGTGG - Intronic
901007682 1:6179779-6179801 GCCGCGCGGCGCCAGCAGGGCGG + Intronic
901434048 1:9235227-9235249 GCCGCTCGGGGCGACCCTGGAGG - Intronic
903055502 1:20633533-20633555 GGGCCGCGGCGCCACCATGGCGG + Exonic
903259440 1:22123321-22123343 GGGGTGCAGGGCCACCAGGGAGG + Intronic
904273934 1:29368111-29368133 AGGGCACGGGGCCATCATGGTGG - Intergenic
911744044 1:101419505-101419527 GGGAGGCAGGGCCACCATGGTGG + Intergenic
915519378 1:156432554-156432576 TCGGCACGGGGCCAGGATGGGGG + Intergenic
919802304 1:201361251-201361273 GCTGGGCGGGGACAGCATGGCGG + Intronic
920111993 1:203593318-203593340 GCGGCGTGATGCCAGCATGGTGG - Intergenic
921356633 1:214290598-214290620 GGGACGCGGAGTCACCATGGAGG + Intronic
921866770 1:220094498-220094520 TCGGCGCGGGGCCTCCAGAGAGG + Intronic
922416493 1:225427647-225427669 GCGCCGCGCCGCCAACATGGAGG + Intronic
922478881 1:225924728-225924750 GCGGCGAGGCGGCACCAGGGTGG + Intergenic
923171505 1:231421651-231421673 GCGGCGCGGGGCCGGAATGCTGG + Exonic
923249482 1:232166871-232166893 GCGGCGGGGGGGTACCATGCAGG + Intergenic
924527283 1:244863761-244863783 GCAGCGCGGGGCCGCCAAGGAGG - Exonic
1067071893 10:43138512-43138534 GCGCCGCGGGGACACCCGGGCGG - Exonic
1069836692 10:71313725-71313747 GCAGCGTGGGCCCACCCTGGGGG - Intergenic
1070609964 10:77926503-77926525 CCGGCGCTGGGGCTCCATGGTGG + Exonic
1074503243 10:114044468-114044490 GCCGTTCGGGGCCACCATCGTGG + Exonic
1074687633 10:115974860-115974882 AGGGCTTGGGGCCACCATGGGGG + Intergenic
1076670005 10:132115238-132115260 GCGGCTAGGGGTCACCCTGGTGG + Intronic
1076670015 10:132115273-132115295 GCGGCTAGGGGTCACCCTGGCGG + Intronic
1076750098 10:132538081-132538103 GCGCCGCCCGGGCACCATGGCGG + Exonic
1077037926 11:504200-504222 GGGGCGCGGGGCCACCCTCTAGG + Intronic
1079451184 11:20601186-20601208 GCGGCGCAGGGCCACCCGGATGG + Exonic
1083262915 11:61532822-61532844 GCGCCGAGTGGCCACCATGCTGG + Intronic
1083669576 11:64292398-64292420 GGGGCGCGGGGGCACCCTGGAGG + Intronic
1084072254 11:66744366-66744388 ACGGCGCGGGGCTACCAAGCGGG - Intergenic
1085050336 11:73376909-73376931 GCGGCGCGGGGCGGCCAAGGGGG + Intronic
1085423094 11:76380703-76380725 GCGGCCCGGGCCCACCTTCGCGG - Intronic
1091665484 12:2415765-2415787 GGGGGACGAGGCCACCATGGCGG - Intronic
1096592779 12:52672779-52672801 GCTGCTCAGGGCCTCCATGGAGG - Intergenic
1102300421 12:111767151-111767173 GCGGCGCGGGGCCTTCCTAGGGG - Intronic
1103085787 12:118061108-118061130 GCGGCGCGGGGGCGGCATGAGGG - Intronic
1103521318 12:121538144-121538166 GCGGCGCGGGGCCGCCAGGGAGG + Intronic
1104844225 12:131838761-131838783 GAGGAGCGGGGCCTCCGTGGAGG + Intronic
1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG + Intronic
1120358008 14:83458992-83459014 GAGGGGAGGGGCCACCATGAAGG - Intergenic
1121273285 14:92651864-92651886 GCGGCGTGGGGCCCACCTGGAGG - Exonic
1121816907 14:96935619-96935641 ACATCGCGAGGCCACCATGGTGG + Intergenic
1122598140 14:102907632-102907654 GCCGCGCGGGGACAGCTTGGTGG + Exonic
1122719818 14:103715846-103715868 GCGGCGCGCGGACACCTCGGAGG - Exonic
1122885464 14:104708547-104708569 GGCCCGGGGGGCCACCATGGTGG - Exonic
1128594411 15:68930742-68930764 GCGGACCGGGGACACCCTGGGGG + Intronic
1130113979 15:80989967-80989989 GTGGGGCGGGGCCAAAATGGCGG - Intergenic
1132324672 15:100958819-100958841 GCAGCGCGGGGTCAGCATGGTGG + Intronic
1132601713 16:775794-775816 GCGTCGTGGGGCCTCCTTGGTGG - Intronic
1132690258 16:1178885-1178907 AGGGCGCGGGGCCACCCTGCTGG - Intronic
1132734725 16:1379703-1379725 GCGGGGCGGGGCCAGCGCGGAGG - Intronic
1132889183 16:2195912-2195934 GCGGCGAGGGGCGACCCGGGAGG - Intronic
1133090666 16:3401409-3401431 GGGCCGCGGGGCCGCCCTGGAGG + Exonic
1134584074 16:15396041-15396063 GCGGCGCGTGGCCACGTTGGTGG + Exonic
1136192219 16:28623275-28623297 GCGGCGCGTGGCCACGTTGGTGG - Exonic
1136574764 16:31116969-31116991 GCGGCTCCAGGCCACCAGGGCGG + Intronic
1136627704 16:31472150-31472172 GTGGCGCGGGGCGAACAGGGCGG - Exonic
1140927547 16:79599050-79599072 GCTGCGCGGGGTCAGCAAGGAGG - Exonic
1142403770 16:89874354-89874376 GAGGCCTGGGGCCACCGTGGGGG + Intronic
1145063688 17:19748035-19748057 GCGGAGCAGGGACACCAAGGTGG - Intronic
1148571608 17:48674365-48674387 GAGGCGAGGTGCCACCATGTTGG - Intergenic
1148740669 17:49890713-49890735 GCGGCGCGAGGCCAGCCTAGGGG - Intergenic
1149758754 17:59210158-59210180 GCGGACCGGAGCCTCCATGGCGG + Exonic
1151598745 17:75093692-75093714 GAGGCCCTGGGTCACCATGGTGG - Exonic
1151880497 17:76891851-76891873 GCAGCACGGGGCCAGCCTGGTGG + Intronic
1151919289 17:77141301-77141323 GCGGCGAGGGGCGAGCAGGGGGG - Intronic
1152111368 17:78359359-78359381 GCTGCCCGGGGCCACCCTGCCGG - Intronic
1152703891 17:81833153-81833175 GCCGCGCGGCGACACCAGGGCGG + Intronic
1161028170 19:2046171-2046193 GCGGCGCGGGCCCACCTTGACGG + Exonic
1162021393 19:7870007-7870029 GCGGCGTGGGGCCTGCAGGGTGG + Exonic
1162482374 19:10935687-10935709 GTGGTGCAGGGCCACCATGTAGG + Intergenic
1163292019 19:16385098-16385120 GAGGCGCGGGGGCTCCGTGGAGG + Intronic
1163529696 19:17842275-17842297 GCTGGGCGGGGCCAACGTGGGGG - Intronic
1168308977 19:55451421-55451443 GCGGGGCGGGGAGACCCTGGGGG + Intergenic
1168354998 19:55695301-55695323 GGGGCCCGGGGGCATCATGGGGG - Exonic
925185532 2:1843822-1843844 ACAGCTCTGGGCCACCATGGAGG + Intronic
925419987 2:3703862-3703884 GCGCCGCGCGGCCACCTTCGAGG + Exonic
926349807 2:11984503-11984525 TCAGCGCTGGGCCAGCATGGGGG - Intergenic
927781021 2:25939452-25939474 GCGGGTCGGGGACAGCATGGAGG - Intronic
929188585 2:39120416-39120438 GCGCCCCGGGGGCACCATGCAGG - Exonic
929789724 2:45013886-45013908 GGGGCTCGGGGCCAGCCTGGAGG + Intergenic
937238504 2:120445079-120445101 GGGGCTTGGGGCCACCTTGGAGG + Intergenic
937308464 2:120886739-120886761 GCGGCTTGGGGCCAGCATGCAGG - Intronic
938014749 2:127858094-127858116 GCGGCGCGGCGCGGCGATGGCGG - Exonic
943639630 2:190343988-190344010 GCGGCGCGGGGACCCTGTGGTGG - Intronic
1168951185 20:1803306-1803328 GCGGCGCAGGGCGAGCCTGGAGG + Intergenic
1169557553 20:6767483-6767505 GGGGCGCGCGGCCGCCAAGGGGG - Intergenic
1172446806 20:34997463-34997485 GCGGCACGAGGCCACAGTGGCGG + Exonic
1175210573 20:57351416-57351438 GCGGCACGGGGCCTACCTGGGGG - Exonic
1176139383 20:63538329-63538351 GCGGGGAGGGGCCTCCAGGGAGG - Intergenic
1181036308 22:20171431-20171453 GCCGGGAGGGGCCAGCATGGTGG + Intergenic
1181813676 22:25421037-25421059 GCGGCGCGCCGCGACCCTGGCGG + Intergenic
1182639305 22:31753923-31753945 GCGGCGCGGGGGCGCGAGGGCGG + Intergenic
1184153002 22:42649298-42649320 GCTGAGCTGGGCCCCCATGGTGG + Intronic
1184153003 22:42649309-42649331 GCGGCGCGGGGCCACCATGGGGG - Intronic
1184499581 22:44863657-44863679 GCACGGAGGGGCCACCATGGGGG - Intergenic
1185384578 22:50525965-50525987 GGGGTGCGGGGCCAGCAGGGCGG + Intronic
950940356 3:16885024-16885046 GGGTCGCGGGGCGCCCATGGCGG + Intronic
953975826 3:47381092-47381114 GCGGGGCACGGCCTCCATGGCGG - Exonic
954291666 3:49653175-49653197 GGGGCCCGGGGACCCCATGGCGG + Exonic
963906788 3:150779496-150779518 CCGGCCCTGGACCACCATGGAGG - Intergenic
965586562 3:170324051-170324073 GTGGCTCATGGCCACCATGGTGG - Intergenic
965596859 3:170419062-170419084 CAGGCACGTGGCCACCATGGTGG - Exonic
968636545 4:1683992-1684014 ACGGCGCGGGGCCACCAGGGCGG + Intronic
968701413 4:2059714-2059736 GGGGCGCGGGGCCGCCGGGGGGG + Exonic
969597826 4:8158879-8158901 GCGGGGCGGGGCCGCCAGGAGGG - Intergenic
969669262 4:8580747-8580769 GCAGCCCGGGGCCGCCCTGGAGG - Exonic
982745984 4:159104006-159104028 GCGGCGCGGGGCCCGCGGGGGGG - Intergenic
985783299 5:1881881-1881903 GCGGCGCTGGGCGTCTATGGGGG - Exonic
988949509 5:36242318-36242340 GCGGCGCGGGGCCAGCGGGTGGG + Intergenic
992769712 5:80035533-80035555 TCCGCGCGGGGCCAGCATGTTGG - Exonic
1002055707 5:176596963-176596985 GCGGCGCGGGCGCCCCTTGGCGG + Exonic
1002300084 5:178252976-178252998 GTGGTGCTGGGCCACCATTGGGG - Intronic
1003083859 6:3045368-3045390 GCAGCACAGGGTCACCATGGTGG + Intergenic
1005583072 6:27251514-27251536 GTGGGGCGGGGCCACAATGGAGG + Intronic
1005667561 6:28073713-28073735 GAGGCGCAGGGCCATAATGGTGG - Intergenic
1015024650 6:128519495-128519517 GGAGCGCGGGGCCAGCCTGGCGG + Intronic
1017880544 6:158559963-158559985 CCGGCACGGGGCCACGAAGGAGG + Intronic
1018854105 6:167663134-167663156 GCTCTGCGGGGCCACCGTGGGGG + Intergenic
1020274503 7:6616036-6616058 GAGGCGCAGGGCCACCCCGGGGG - Exonic
1022230658 7:28409713-28409735 GCGGCGCGGGGTCTCTAGGGTGG - Intronic
1025089654 7:56051718-56051740 GCGGCGCGCGGGCACGCTGGGGG + Exonic
1028417581 7:90596355-90596377 GCGGCGCGGGGCCACCACGGCGG + Intronic
1035129799 7:156640969-156640991 GCGGCGCGCAGCCTCCTTGGGGG + Exonic
1035709511 8:1701459-1701481 GCAGCGCGGCGCCGCCCTGGTGG + Exonic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1038449961 8:27633702-27633724 GGGGCGCGGGGCCCCCGCGGCGG + Intergenic
1041244992 8:55880636-55880658 CCTGCCCGGGGCCACCAGGGAGG - Intronic
1049406224 8:142452856-142452878 CCGGCGCGGGGCCGCAGTGGCGG + Intronic
1049523652 8:143108934-143108956 GCGGCGCGGGCGGATCATGGAGG - Intergenic
1049665541 8:143841111-143841133 GCGGGGCGGGGCCTCCGGGGGGG - Intergenic
1049668489 8:143859273-143859295 CCTGCGTGCGGCCACCATGGAGG - Exonic
1049668907 8:143860881-143860903 CCTGCGTGCGGCCACCATGGAGG - Exonic
1049669322 8:143862483-143862505 CCTGCGTGCGGCCACCATGGAGG - Exonic
1049669734 8:143864076-143864098 CCTGCGTGCGGCCACCATGGAGG - Exonic
1049670149 8:143865684-143865706 CCTGCGTGCGGCCACCATGGAGG - Exonic
1049681804 8:143922161-143922183 GCGGCTGGTGGCCAGCATGGAGG - Exonic
1049746402 8:144265074-144265096 GCAGCCGGGGGCCACCATGTCGG + Intronic
1056475198 9:86946401-86946423 GCGCCGCGGGCCCGCCCTGGAGG - Exonic
1058663079 9:107283614-107283636 GCTGCGCGGCGGCACCATGCAGG + Exonic
1061563187 9:131419825-131419847 GCGGCGTGGGGCCAGCATGTTGG + Intronic
1062122005 9:134838885-134838907 GGGGTGCGGGGCGGCCATGGGGG + Intronic
1062461864 9:136665700-136665722 GCGGGGCGGGGCCGCCAGGTGGG + Intronic
1062552734 9:137097529-137097551 GAGGCGGGGGGCCTCTATGGTGG - Intronic
1062592224 9:137279421-137279443 GCGGCGCGTGGCCGACGTGGTGG + Exonic
1185621784 X:1454213-1454235 GCGGCGTGGGGACCCCCTGGGGG + Intergenic
1187826101 X:23334532-23334554 GCGGCGCGGAGCCCCCCTGGCGG + Exonic
1193294702 X:79820795-79820817 GTGGCTCGGGGCTATCATGGTGG - Intergenic
1197717369 X:129719202-129719224 GGGGCTCTGGGCTACCATGGAGG - Intergenic
1200151643 X:153954177-153954199 GCAGCGCGGTGCCAGCCTGGGGG + Exonic