ID: 1184158848

View in Genome Browser
Species Human (GRCh38)
Location 22:42686292-42686314
Sequence CTGCAGGCACAGCTGGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184158848_1184158859 26 Left 1184158848 22:42686292-42686314 CCTAGGCCCAGCTGTGCCTGCAG No data
Right 1184158859 22:42686341-42686363 GATCTCCTTGAACTCTGGCCTGG No data
1184158848_1184158856 21 Left 1184158848 22:42686292-42686314 CCTAGGCCCAGCTGTGCCTGCAG No data
Right 1184158856 22:42686336-42686358 TCCCAGATCTCCTTGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184158848 Original CRISPR CTGCAGGCACAGCTGGGCCT AGG (reversed) Intergenic
No off target data available for this crispr