ID: 1184160868

View in Genome Browser
Species Human (GRCh38)
Location 22:42696612-42696634
Sequence CTAGGTTCCCAGCACGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184160863_1184160868 -10 Left 1184160863 22:42696599-42696621 CCCCGGCACCCAGCTAGGTTCCC 0: 1
1: 0
2: 3
3: 49
4: 437
Right 1184160868 22:42696612-42696634 CTAGGTTCCCAGCACGCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 158
1184160859_1184160868 30 Left 1184160859 22:42696559-42696581 CCATGGGAATAAGCATCTAGGGT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1184160868 22:42696612-42696634 CTAGGTTCCCAGCACGCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 158
1184160861_1184160868 4 Left 1184160861 22:42696585-42696607 CCTGCATCTTCTCTCCCCGGCAC 0: 1
1: 0
2: 1
3: 19
4: 323
Right 1184160868 22:42696612-42696634 CTAGGTTCCCAGCACGCAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184160868 Original CRISPR CTAGGTTCCCAGCACGCAGC AGG Intronic
903473948 1:23606714-23606736 CTTGGGTCCTAGCATGCAGCAGG + Intronic
904215518 1:28915309-28915331 CTGGGTTCCCAGCGAGCAGAGGG + Intronic
904340296 1:29829865-29829887 CTAAGTACCCAGGACGCACCAGG - Intergenic
904380091 1:30104780-30104802 CTAGGTCCCAGGCACACAGCAGG + Intergenic
906148926 1:43576535-43576557 CTAGGCTGCCTCCACGCAGCAGG + Intronic
906254496 1:44337606-44337628 CTGGGTTCCCAGCCCTCAGTAGG + Intronic
911657501 1:100461551-100461573 CTAAGTTCCCAGCACACTGATGG - Intronic
913716399 1:121538509-121538531 TTAGATTCCCAGCACGCTACTGG - Intergenic
916092038 1:161314890-161314912 CTGGGTTCCCAGCGGGCTGCTGG + Intronic
919910859 1:202109919-202109941 CTAGGTTCCCAGGCCCCTGCAGG + Intergenic
924030742 1:239882842-239882864 CTGGCTGCCCAGCACGCAGTGGG + Intronic
924595445 1:245441128-245441150 CCAGGTTCCAAGCACGCAGATGG - Intronic
1070399614 10:76041850-76041872 CTGGGTTCCCGGCACACACCTGG - Intronic
1072806667 10:98427715-98427737 CTCAATTCCCAGCACACAGCAGG - Intronic
1076064882 10:127441263-127441285 CTAGGGTCCTTGCAAGCAGCAGG + Intronic
1077414184 11:2416965-2416987 CATGGTTCCCTGCAGGCAGCGGG - Intronic
1077481098 11:2815068-2815090 CATGGTGCTCAGCACGCAGCAGG - Intronic
1080241393 11:30130816-30130838 CTAGGTTGACAGCATACAGCTGG + Intergenic
1082699832 11:56414464-56414486 CAAAGTTCCTAGCACACAGCTGG + Intergenic
1083305869 11:61761675-61761697 ATAGTATCCCAGCACACAGCAGG - Intronic
1083769103 11:64856482-64856504 CCAGGTTCCCAGCTTGCTGCAGG - Intronic
1084115805 11:67042390-67042412 CCAGGTTCTCAGCACACATCAGG - Intronic
1084179370 11:67438808-67438830 CTACGTGCCCAGCAAGCAGCGGG - Exonic
1084618298 11:70251270-70251292 CTCGGTCTCCAGCACGAAGCAGG - Intergenic
1084786333 11:71443861-71443883 CTGGGTTCCCGGGACCCAGCAGG - Intronic
1085345912 11:75768229-75768251 CTGGGTCCCCAGCACCCAGCAGG + Intronic
1086735698 11:90302733-90302755 CTAGGTTTCCAGCACAAAACTGG - Intergenic
1090080743 11:123610841-123610863 CTTTATTCCCAGCACCCAGCTGG + Intronic
1090434126 11:126672678-126672700 CTTGGTTCCCAGCATGGAGCTGG + Intronic
1092581727 12:9849687-9849709 CTGGGTTTCCAGCACAAAGCTGG - Intergenic
1095800921 12:46269264-46269286 CTGGGTTCCGAACACGCCGCCGG - Intronic
1096958639 12:55554129-55554151 CCAGCTACCCAGCATGCAGCTGG - Intergenic
1102622441 12:114206930-114206952 CTAGATTCCTAGCACATAGCAGG + Intergenic
1105514536 13:21077707-21077729 CTGGGATCCCAGCACTCAGGAGG - Intergenic
1107199371 13:37695401-37695423 GTAGGCTCCCAGCACACTGCAGG - Intronic
1107988352 13:45795420-45795442 AGAGTTTCCCAGCACTCAGCAGG + Intronic
1119648218 14:76364026-76364048 CCAGGTTCCCAGCACAGAGTAGG + Intronic
1122967183 14:105136823-105136845 CCAGGTTCCCAGCCTGCAGCCGG + Intergenic
1202928032 14_KI270725v1_random:11037-11059 TGGTGTTCCCAGCACGCAGCTGG + Intergenic
1123986053 15:25647274-25647296 CTAGGTTCCCCACAGACAGCTGG - Intergenic
1124631220 15:31338730-31338752 CCAGGATCCCAGCAGGCTGCTGG - Intronic
1124856084 15:33390729-33390751 CTAGATTCCCAGAACTAAGCAGG - Intronic
1128069729 15:64787361-64787383 CTTTGTGCCCAGCACACAGCTGG - Intergenic
1129203258 15:74018932-74018954 CAAAGTGCCAAGCACGCAGCAGG + Intronic
1131533483 15:93214446-93214468 CTAGGTGCCCAGCATGCAGGAGG - Intergenic
1133739631 16:8641361-8641383 TGAGGTGCCCAGCATGCAGCAGG - Intronic
1138324756 16:56155146-56155168 TGATTTTCCCAGCACGCAGCTGG + Intergenic
1141531959 16:84652628-84652650 CTATGTTGCCAGCACCCAGATGG + Intronic
1141980438 16:87546977-87546999 CTAGCTTTCCAGCAGGCAGGGGG + Intergenic
1142289392 16:89185825-89185847 CTAGGTGCCCAGCACAGAGTAGG + Intronic
1144793254 17:17873666-17873688 CTTCGTCCCCAGCACCCAGCTGG - Intronic
1145251135 17:21297666-21297688 CCAGGTGCACAGCACTCAGCTGG - Intronic
1145868385 17:28255264-28255286 CCAGGTTCCCAGAGAGCAGCAGG + Intergenic
1147248027 17:39134899-39134921 CCAGGTTTCCATCATGCAGCTGG + Intronic
1147267178 17:39241730-39241752 CTATAATCCCAGCACACAGCAGG - Intergenic
1147935497 17:44008331-44008353 CTGGGTGCCCAGCATGCAGTAGG + Intronic
1148259037 17:46163217-46163239 CTAGCATCCCAGCATGTAGCAGG + Intronic
1148788086 17:50155731-50155753 CTCAGTGCCCAGCACGCAGGTGG + Intergenic
1149263081 17:54900423-54900445 CAAGGTGCCCAGCAAGCGGCAGG + Intronic
1151313681 17:73309692-73309714 CTAGGGTCCCTGCACACAGAGGG - Intronic
1152666056 17:81570307-81570329 CTGGGTGCCCAGCACGGGGCTGG + Intronic
1152745248 17:82035843-82035865 CTAGGCTGCCAGCAGGTAGCTGG - Exonic
1154154415 18:11932652-11932674 CAAGGTACCCAGCCAGCAGCTGG - Intergenic
1157611090 18:48956099-48956121 CTAGATTCCTAGCCAGCAGCCGG - Intergenic
1160054965 18:75470496-75470518 CCAGGTTCCCAGTCCCCAGCAGG - Intergenic
1160704288 19:522710-522732 CCAGTTTCCCAGCACTGAGCTGG + Intergenic
1161072304 19:2269115-2269137 CTAGGGTCCCTTCACGCAGCGGG - Intronic
1161423849 19:4191226-4191248 CCAGTTTCGCAGCAGGCAGCCGG + Intronic
1161439912 19:4285064-4285086 CTGGGTGCCTGGCACGCAGCAGG - Intronic
1162052886 19:8045709-8045731 CTATGTGCCCAGCACTGAGCTGG - Intronic
1162154142 19:8665147-8665169 CTAGGTTCCCAGGACCCAGTGGG - Intergenic
1163209783 19:15831793-15831815 CCAGTATCCCAGCCCGCAGCAGG + Intergenic
1164051741 19:21589768-21589790 CTAAGTGCCCAGCACACACCTGG + Intergenic
1164700817 19:30282667-30282689 ACAGGTCCCCAGCACCCAGCCGG - Intronic
1164732744 19:30518728-30518750 CTAGGTGCCCAGCACATAGTAGG - Intronic
1166795540 19:45423422-45423444 CTACGTTCTCATCCCGCAGCAGG + Exonic
1167792595 19:51690858-51690880 CTGGGTTCCCAGCATGCCCCGGG - Intergenic
924991536 2:316761-316783 CTAGGATGCCAGCAAGCACCTGG + Intergenic
928421216 2:31138735-31138757 CTTGGGTCCCAGCTGGCAGCTGG - Intronic
931201779 2:60104622-60104644 CTAGGTTCACAGAAAGCATCTGG + Intergenic
934164434 2:89281395-89281417 CTAGATTCCCAGCATGGAGGAGG - Intergenic
934202840 2:89901129-89901151 CTAGATTCCCAGCATGGAGGAGG + Intergenic
934618307 2:95789050-95789072 CTGTGTTCCCAGCACCCAGCAGG - Intergenic
934642586 2:96035509-96035531 CTGTGTTCCCAGCACCCAGCAGG + Intronic
934691878 2:96367396-96367418 CTAGGTGCCCAGCATGCGGGAGG + Intronic
935640506 2:105285543-105285565 CCAGGTACACAGCAGGCAGCTGG + Intronic
936038886 2:109134096-109134118 CAAAGTGCCCAGCATGCAGCAGG - Intronic
940023954 2:149185359-149185381 ATAGGTTCCCAGCTCACAGGAGG - Intronic
940666127 2:156612111-156612133 CTAGAGTCCCAGCACTCAGGAGG - Intronic
940904075 2:159153106-159153128 CTAGGTTCCTAGCATGGTGCTGG + Intronic
941257162 2:163246390-163246412 CTAGCCTCCCAGGAGGCAGCCGG - Intergenic
946105543 2:217366313-217366335 CTGAATTCCCAGCACACAGCAGG + Intronic
946865828 2:224039902-224039924 CTGGGTTCCCAGGACGCTGCGGG - Intergenic
947866132 2:233399261-233399283 CCAAGTTCCCAGCACACAGTAGG + Intronic
948591684 2:239054440-239054462 CTAGGTCCCCAGCTAGCAGCGGG - Intronic
1168813996 20:724165-724187 CTTGGTGCCCACCACACAGCAGG + Intergenic
1169546425 20:6655391-6655413 CAAGGTCCCCAGCAAGGAGCTGG - Intergenic
1171373228 20:24674990-24675012 CTTGGTCCCCACCACTCAGCTGG + Intergenic
1171448106 20:25218751-25218773 CTGGGTGCCCAGCATGCAGCGGG - Intronic
1172179324 20:32991244-32991266 CTGGATCCCCAGCACGCAGTAGG + Intronic
1172812418 20:37658341-37658363 CTAGGATCCCAGCAGCCAGAAGG + Intergenic
1173100290 20:40081510-40081532 CTAGGTAGCCAGCAAGCAGATGG + Intergenic
1180272887 22:10616691-10616713 TGGTGTTCCCAGCACGCAGCTGG + Intergenic
1180751682 22:18128976-18128998 CTATGAGGCCAGCACGCAGCTGG - Intronic
1180839473 22:18952440-18952462 CTCAGCTCCCTGCACGCAGCAGG + Intergenic
1181062427 22:20288039-20288061 CTCAGCTCCCTGCACGCAGCAGG - Intergenic
1181690425 22:24555866-24555888 CTAGTTTCCCAGCCGGCAGGCGG + Exonic
1182170209 22:28221113-28221135 GCAGGATCCCAGCATGCAGCTGG + Intronic
1183422690 22:37721333-37721355 CTGAGTTCCCAGCACCTAGCAGG - Intronic
1184160868 22:42696612-42696634 CTAGGTTCCCAGCACGCAGCAGG + Intronic
955405544 3:58623492-58623514 CGAGGTGCCCAGCACTCAGTGGG - Intronic
955508433 3:59655273-59655295 CCAGGATCCAAGCAAGCAGCAGG - Intergenic
956542527 3:70357579-70357601 CTAGCCTCCCAGCCCCCAGCAGG - Intergenic
956857487 3:73289836-73289858 CCTGGCTCCCAGCACACAGCAGG - Intergenic
956865759 3:73367072-73367094 CTGGGTGCCCAGCACACAGTAGG + Intergenic
959353448 3:105296857-105296879 CCATTCTCCCAGCACGCAGCTGG + Intergenic
960588777 3:119345591-119345613 CTAGGTTCCAAGGACACAGTGGG - Intronic
963223122 3:142832702-142832724 CCAGGTGCCCAGCACACAGCCGG + Intronic
965324726 3:167289645-167289667 CTTGGTTTCCAGCACGAAACTGG + Intronic
968471691 4:785604-785626 CGGGGTTCCCTGCGCGCAGCTGG - Exonic
973876930 4:55229526-55229548 TGAGATTCCCAGCAAGCAGCAGG - Intergenic
975492016 4:74999589-74999611 CTGGGTTCCTTGCACACAGCAGG + Intronic
979614929 4:122732418-122732440 CCAGGTCCCCAGCCGGCAGCCGG + Intergenic
986970606 5:13331967-13331989 CTTGGTTTCCACCACACAGCTGG - Intergenic
987035580 5:14015124-14015146 CAAGGTTCCCATCACTGAGCTGG - Intergenic
991161332 5:63507306-63507328 CTAGGTTTCCAGCACAAAACTGG + Intergenic
991184544 5:63792141-63792163 CTAGGTTACCAGCACTCTGAGGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
997209965 5:132071465-132071487 CTAGGTTCCCAGCAGGGAAAAGG - Intergenic
997466420 5:134090886-134090908 ATAGGTTACCACCACCCAGCTGG - Intergenic
997528297 5:134567359-134567381 CCTGTTTCCCAGCACACAGCTGG - Intronic
999134952 5:149312315-149312337 GTAGGTGCCCAGCACAGAGCTGG + Intronic
1001266484 5:170278188-170278210 CTAAGTTCCCAGCACTTAGAAGG - Intronic
1001453754 5:171845575-171845597 CTGGATCCTCAGCACGCAGCGGG + Intergenic
1002305165 5:178278840-178278862 CTGGGCTCACAGCAGGCAGCAGG + Intronic
1006844323 6:37051845-37051867 CTGTGTGCCCAGCACGGAGCTGG + Intergenic
1007409056 6:41651210-41651232 CCAGGTTTCCAGCACATAGCAGG - Intronic
1010869225 6:81017552-81017574 GTGGTTCCCCAGCACGCAGCTGG - Intergenic
1013118211 6:107119106-107119128 CTAGGGCCCCAGCACCCAGAGGG + Intergenic
1018567751 6:165173731-165173753 CCAGGTTGCCAGCTCTCAGCTGG - Intergenic
1020106109 7:5423148-5423170 CTCGGTTCCCAGCAGGCGGCGGG - Intronic
1021722139 7:23514934-23514956 CTAGGTTTCAACCAGGCAGCCGG - Intronic
1021952338 7:25787412-25787434 CTAGCTGCCCAGCAAGCTGCAGG - Intergenic
1022050382 7:26662812-26662834 CTGGGTTCCCAGAAAGCAGAGGG + Intergenic
1022835486 7:34109733-34109755 CAAGGTTCGCAGCAGGCATCTGG - Intronic
1029513154 7:101009364-101009386 CTGTGTTCCCAGCACCCAGCAGG - Intronic
1030401517 7:109057470-109057492 CTAAGTTCCCATCAACCAGCCGG - Intergenic
1032717310 7:134520615-134520637 CTAGCTCCCCAGCCCCCAGCAGG - Intergenic
1033545167 7:142392979-142393001 CTAGGTTCACAGCAAATAGCAGG + Intergenic
1035063790 7:156090927-156090949 CTAGGCAAACAGCACGCAGCTGG + Intergenic
1035534751 8:382404-382426 CTACTTTCTCAGCACGAAGCGGG + Intergenic
1035654759 8:1297055-1297077 GCAGGTTCCCAGCACAGAGCAGG + Intergenic
1036560862 8:9899350-9899372 CTCGCTTCCCAGCACGCAAGAGG - Intergenic
1037963807 8:23118091-23118113 CAGGGTCCCCAGTACGCAGCTGG - Intergenic
1040080030 8:43275938-43275960 CTTGGTTCCCAGCACCCACCTGG - Intergenic
1042696084 8:71556617-71556639 GCAGGTTCCCAGCTCTCAGCTGG + Intronic
1042792455 8:72623632-72623654 CCAGGCTCCCAGCACACAGGAGG + Intronic
1047541300 8:125768899-125768921 CTTTGTTCTCAGCAGGCAGCTGG + Intergenic
1047689929 8:127341449-127341471 CAAGGTTCCCAGCACACAGTTGG + Intergenic
1048867181 8:138769702-138769724 GTAGGCACCCAGCACACAGCGGG + Intronic
1049155080 8:141061457-141061479 CTTGGTTCCCAGTATACAGCAGG - Intergenic
1049297731 8:141852132-141852154 CTCTGTTCTCAGCACACAGCTGG - Intergenic
1049444319 8:142623064-142623086 CAAGGTGCCCGGCACACAGCAGG - Intergenic
1049709038 8:144055482-144055504 CTGGGCTCCCAGCAAGCCGCTGG + Intronic
1052096631 9:24391575-24391597 CTGGGTTTCAAGCACGAAGCTGG - Intergenic
1056548146 9:87629895-87629917 CAAGTGTCCCAGCACGCAGGTGG - Intronic
1058110673 9:101028546-101028568 CGGGGTTCCCAGAAGGCAGCGGG - Intergenic
1059657687 9:116370869-116370891 CTTGGTGCCTAGCACACAGCAGG + Intronic
1060273963 9:122168212-122168234 CTAAGTTCCCAGCACACAAGAGG + Intronic
1061057893 9:128233861-128233883 CTAGGGTCCCAGGACGCTGATGG - Intronic
1061862306 9:133474220-133474242 ATAGATGCCCAGCACGCTGCAGG - Intronic
1062571708 9:137188823-137188845 CCGGGTTCCCGGCTCGCAGCGGG + Intronic
1203620071 Un_KI270749v1:118351-118373 TGGTGTTCCCAGCACGCAGCTGG + Intergenic
1192101089 X:68265182-68265204 CAGTTTTCCCAGCACGCAGCTGG + Intronic
1195814421 X:108869457-108869479 CTTGGTTCCCAGGATGGAGCAGG - Intergenic
1196606128 X:117659111-117659133 CTCAGTGCCCAGCACACAGCAGG - Intergenic
1198437277 X:136629608-136629630 CTGTGTGCCCAGCATGCAGCTGG + Intergenic