ID: 1184162350

View in Genome Browser
Species Human (GRCh38)
Location 22:42704541-42704563
Sequence CTGTTTGTAAGAAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184162350 Original CRISPR CTGTTTGTAAGAAGGGCAGA AGG Intronic
900457689 1:2785458-2785480 CTATTTCTAGGAAGGGCTGAGGG + Intronic
901248788 1:7756457-7756479 TAGTTTGTAAGCAGGGCAAAAGG + Intronic
903562311 1:24237140-24237162 CTGGTTGTAGGATGGGGAGAGGG + Intergenic
904700816 1:32357091-32357113 CTTTTTCTTAGAAGAGCAGATGG + Intronic
905876262 1:41433694-41433716 ATGTTTGTGCGATGGGCAGACGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
906955529 1:50370782-50370804 CTGCTTTTCAGAGGGGCAGAAGG - Intergenic
907711731 1:56889330-56889352 CTGTTTGTCAAAAGGAAAGAAGG - Intronic
907774573 1:57501233-57501255 CTCCTTGTAAGAAGGCCAGAAGG + Intronic
908655650 1:66385474-66385496 CTGTTTGTAACAAGGGCTATGGG - Intergenic
911060699 1:93745349-93745371 GCGTTTGTGAGAAGAGCAGAGGG + Intronic
911072068 1:93839995-93840017 ATTTTTGCAGGAAGGGCAGAGGG + Intronic
912871526 1:113311237-113311259 CTGCTTGAAAAAAAGGCAGAGGG + Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
916576451 1:166071187-166071209 CTGGTGGAAAGAAGGGCAAAAGG + Intronic
916658144 1:166896261-166896283 CTATTTGGAGGAAGAGCAGATGG + Intergenic
916929435 1:169560102-169560124 TTGTTTGTAAGAAAGGAAGCTGG + Intronic
917662430 1:177190486-177190508 CTGTTTTGGAGAAGGGAAGAAGG - Intronic
918508537 1:185284561-185284583 TTGCTTGTAACAAGGGCTGAGGG - Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921487387 1:215731321-215731343 CTGTTTTTTAGCAGTGCAGATGG - Intronic
921672220 1:217938245-217938267 CTGTTTGGAAGAGGGGAAAAAGG - Intergenic
923364401 1:233245487-233245509 ATGTGTGCAAGAAGGGCTGAGGG + Intronic
923386380 1:233469313-233469335 CCGCTTGTAACAAAGGCAGAAGG - Intergenic
923466641 1:234253550-234253572 CTGTTAGTAGGATGGGAAGAGGG + Intronic
923804621 1:237244415-237244437 CTGATAGAGAGAAGGGCAGATGG - Intronic
923834018 1:237589906-237589928 CTGTTTGTATTAACGGCAAATGG - Exonic
924262702 1:242248596-242248618 CTGTTTGTAACAAAGGCTGAAGG + Intronic
924481889 1:244442990-244443012 CTATGTATTAGAAGGGCAGATGG + Intronic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1066059566 10:31709775-31709797 CTGTCTGTAAGAAGGGATGAAGG - Intergenic
1066725530 10:38388334-38388356 CTGTTTGTAACAAAGGCTGAAGG - Intergenic
1067465028 10:46491399-46491421 GTGCTTGTGAGAAGGGCAGCTGG - Intergenic
1067622160 10:47893202-47893224 GTGCTTGTGAGAAGGGCAGCTGG + Intergenic
1068517020 10:58037535-58037557 CTTTTTGTAAGAAGGGAATTGGG - Intergenic
1071508524 10:86247095-86247117 CTGATGGTCAGAAGGACAGATGG + Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1073951039 10:108809677-108809699 TTGTTTGTAAGAAAGGAACAGGG - Intergenic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1076321628 10:129586823-129586845 CTGTTCATAAAAACGGCAGAGGG - Intronic
1076436086 10:130442820-130442842 GTGTTTGTAATAAGATCAGAGGG + Intergenic
1078493824 11:11796243-11796265 CTGATTGTAAAAAGGGCCAATGG - Intergenic
1078856295 11:15208587-15208609 GTCTTTGTTAGAAGGGGAGAGGG - Intronic
1079034595 11:17011278-17011300 GTGTTTCTAAGAAGGTGAGAGGG - Intronic
1079393041 11:20038903-20038925 CTGATTGAAAGAAGAGGAGACGG + Intronic
1079487486 11:20950614-20950636 CTGTTTCAGAGAAGGGGAGAAGG - Intronic
1083327792 11:61881958-61881980 CTGGTAGAAAAAAGGGCAGAGGG + Intronic
1084854365 11:71972671-71972693 CTGGTTGTTACAAGTGCAGAAGG - Intronic
1086068118 11:82768158-82768180 CTGGATGAAAGAAGGACAGAGGG + Intergenic
1088784144 11:113165427-113165449 CTGCTTGTAAGACAAGCAGAAGG - Intronic
1089264245 11:117246927-117246949 AGCTTTGTGAGAAGGGCAGAAGG + Exonic
1089859048 11:121572605-121572627 CTGTTTCTAAGCAGGGCTGCAGG + Intronic
1091856249 12:3742693-3742715 CTGTCTATAAGATGGACAGAAGG + Intronic
1093262819 12:16961032-16961054 CCATTTGTAGGAAGGCCAGATGG + Intergenic
1094725785 12:33114354-33114376 CTGTTTTTAAAAATGGTAGATGG - Intergenic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1095095339 12:38144860-38144882 CTGTTTGTTCTTAGGGCAGATGG - Intergenic
1096060706 12:48697130-48697152 CTTTTTTTAAAAAGGGAAGAAGG + Intronic
1096449319 12:51723894-51723916 CTGTTTTTGAGATGGGGAGAAGG + Intronic
1098590698 12:72208175-72208197 GTGTGTGTATAAAGGGCAGAGGG - Intronic
1098931439 12:76419434-76419456 CTGCTTATAATAAAGGCAGAGGG + Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104993266 12:132638750-132638772 CTATTTGTAACAACGGCACAAGG + Intronic
1107192742 13:37609148-37609170 CTCTTTGTAAGAAATGCAAAAGG - Intergenic
1107711349 13:43153318-43153340 GTGCTTGTAAGAAGAGGAGAGGG - Intergenic
1108437994 13:50420284-50420306 CTCTTTGTAAGACAGGCAGTAGG - Intronic
1110154868 13:72304226-72304248 TTATTTGTAAGAAAGGCAGCAGG + Intergenic
1110734765 13:78923488-78923510 CTGCTTGTAGCAAGGGCAGGTGG - Intergenic
1110790866 13:79585303-79585325 CACTTTGTAAGAAGAGCATATGG + Intergenic
1112686323 13:101832103-101832125 CTCCTCGTAAGAAAGGCAGAGGG + Intronic
1112896927 13:104310871-104310893 TTTCTTGTAAGAGGGGCAGATGG - Intergenic
1113102297 13:106733724-106733746 ATGTTTGTAAAAAGGGGACAGGG + Intergenic
1113799343 13:113078340-113078362 CTGTTGGGAAGAAGGGGAGCGGG - Intronic
1116410711 14:44619784-44619806 CTGGTTGAAATAAAGGCAGAGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117442369 14:55772014-55772036 CTCTTTGTACTCAGGGCAGAGGG + Intergenic
1120218621 14:81707333-81707355 CTCTTTGTCAGATGGGTAGATGG + Intergenic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121561856 14:94881831-94881853 CTGTTTCTCAGATGGGAAGATGG + Intergenic
1122420808 14:101575913-101575935 CTGTTTGTTAGAAAGGGATAAGG + Intergenic
1124018443 15:25898322-25898344 CTGAATGTAAGAAGGTCAGCAGG + Intergenic
1126662753 15:51048555-51048577 CTCTTTGAAAAAAGGGAAGAAGG - Intergenic
1127134981 15:55910677-55910699 CTGTTTTCAAGTAGGGCAGTTGG - Intronic
1127484089 15:59403442-59403464 CTGTCTGCAAGCAGGGGAGAGGG + Intronic
1131653142 15:94423923-94423945 CAGTTTGTAAGTGGGGCAGTAGG - Intronic
1132528013 16:426904-426926 CTCCTTTTAAGAAGGGAAGAGGG - Intronic
1133001457 16:2853550-2853572 CTGTCTGGAAGACGGTCAGATGG - Intronic
1135151431 16:20010045-20010067 CTTGTTGTGAGAAGGCCAGATGG - Intergenic
1135177469 16:20243225-20243247 ATGTGTGTTAGAAGGGCAGTGGG + Intergenic
1135946145 16:26866697-26866719 CTCTTTGTCAGAGGGGCAAATGG - Intergenic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1137822208 16:51456980-51457002 CTGTTGGAAAGAAGTTCAGAGGG + Intergenic
1138215805 16:55204354-55204376 CTTTTTATGTGAAGGGCAGAGGG - Intergenic
1138863245 16:60785399-60785421 TTGTGTGTAAAAAAGGCAGAGGG - Intergenic
1140686470 16:77438299-77438321 ATGTTTGTAAGAGGAGCAGAGGG + Intergenic
1141354084 16:83327029-83327051 AGGGTTGTAAGAATGGCAGAGGG + Intronic
1141354193 16:83328198-83328220 AGGGTTGTAAGAATGGCAGAGGG + Intronic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1144070254 17:11665283-11665305 CTGTTAGCAATAAAGGCAGAAGG + Intronic
1144132119 17:12256168-12256190 CTGTGTGTAAGAATGTAAGAAGG - Intergenic
1144363686 17:14521291-14521313 CTCTTTCTAAGAACAGCAGAAGG + Intergenic
1145016750 17:19403754-19403776 ATGTTTGTAACATGGACAGATGG + Intergenic
1147562735 17:41518974-41518996 GTGTTTGTCAGGAAGGCAGAAGG - Exonic
1148156162 17:45426240-45426262 CTGTTTGTACTCAGGGCAAATGG + Intronic
1148622034 17:49042062-49042084 CAGTTTGTAACCAGGGCAGGGGG - Intronic
1148695100 17:49554002-49554024 CTGTTTGTAAGAAGGAGCCAGGG + Intergenic
1149321750 17:55488341-55488363 GTGTTTGAAAGAAAGGCAAAGGG - Intergenic
1150387831 17:64774858-64774880 CTGTTTGTACTCAGGGCAAATGG + Intergenic
1150593720 17:66585258-66585280 CTGGTTGACAGAAGGGAAGATGG + Intronic
1150810564 17:68353590-68353612 CGGTGGGTAAGAAGGGCAGCAGG - Intronic
1151339265 17:73459256-73459278 CAGTGTGTAAGATGGACAGAAGG - Intronic
1152331241 17:79674549-79674571 CAGCTTGCAAGAAGGGCAGTGGG - Intergenic
1153130519 18:1851053-1851075 CTGTTTGTAAGTATGGTTGATGG + Intergenic
1153807970 18:8726396-8726418 CTATCTGTAAGCAGGGAAGAGGG - Intronic
1154059127 18:11042369-11042391 CTGTGTGTATGAAGTGCACATGG - Intronic
1154302122 18:13203444-13203466 CTGATTGAGAGCAGGGCAGAAGG + Intergenic
1155080787 18:22407942-22407964 ATGTTTGTAAACAGGGCAGAGGG - Intergenic
1157859204 18:51125607-51125629 CTGCTTTTCACAAGGGCAGAGGG + Intergenic
1158673827 18:59500790-59500812 GTCTTTGGAAGAAGGGCAGCAGG - Intronic
1159193214 18:65075881-65075903 CTGTTTTAAAGAAGGCAAGAGGG - Intergenic
1159584706 18:70272658-70272680 ATGTTGATAAGAAGGGCAAAAGG - Intergenic
1159971714 18:74664021-74664043 CTGTTAGCAAGAAGTGCAGGAGG + Intronic
1160816641 19:1039051-1039073 CTGTTTGTACGAAGAGAAGGTGG + Exonic
1161527103 19:4763123-4763145 CTGTTTGAAAGATGGGGAAAAGG - Intergenic
1163319247 19:16563368-16563390 CTGTGTGTAATAAGGACAGAGGG + Intronic
1164099571 19:22042911-22042933 CTATTTTTATGAAGGTCAGAGGG - Intergenic
1164119812 19:22256115-22256137 CTATTTTTATGAAGGTCAGAGGG - Intergenic
1164772938 19:30826102-30826124 CTGTAAGTGAGAAGGGTAGAGGG + Intergenic
1168679766 19:58306012-58306034 CTGTTTGAAAGAAGGGGTCAGGG - Intronic
1168680918 19:58315181-58315203 CTGTTTGAAAGAAGGGGTCAGGG - Exonic
925117333 2:1390931-1390953 CTCTTTGTCAGATGGGTAGATGG + Intronic
926223019 2:10948658-10948680 CTGACTGTATCAAGGGCAGAAGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927892498 2:26760679-26760701 CTGTTTGTAACAAAGAGAGAAGG - Intergenic
927892913 2:26763731-26763753 CTATTTGTAAAAGGGGCGGATGG - Intergenic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
929947511 2:46381952-46381974 CTGGGAGTAAGAAGGGCAGATGG - Intronic
932283341 2:70513255-70513277 CTATCTGTAGGAGGGGCAGAAGG + Intronic
937434438 2:121868827-121868849 TTTTTTGTCAGAAGTGCAGATGG + Intergenic
939935351 2:148285169-148285191 CTATTTGTTTGAAGAGCAGATGG - Intronic
940044040 2:149390521-149390543 CTGTCTCTAAGTAGGACAGAGGG - Intronic
942344667 2:174989909-174989931 CTGTTTGTACCAGGGGAAGAAGG - Intronic
943482016 2:188430637-188430659 CTGAGTGACAGAAGGGCAGAAGG - Intronic
945458883 2:210081138-210081160 CTGCTTGTAACAAGGCCAAATGG + Intronic
945715639 2:213354764-213354786 CTCTTTGTCAGATGGGTAGATGG + Intronic
946251107 2:218413087-218413109 CAGTTTGTGGGAAGTGCAGAAGG + Intergenic
947198557 2:227594569-227594591 TTGTTTTTAAGTAGTGCAGATGG + Intergenic
1170066033 20:12311595-12311617 CTGGTTGAAAGCAGGTCAGAGGG - Intergenic
1170942392 20:20859313-20859335 CGGATTGTAAGAAGGACAAATGG + Intergenic
1172527278 20:35607524-35607546 CTGGTGGGCAGAAGGGCAGACGG - Intergenic
1173477870 20:43374973-43374995 CTGTTTGCCAGATGAGCAGAAGG - Intergenic
1173607400 20:44341323-44341345 CTGAGTGAAGGAAGGGCAGAGGG - Intronic
1175089838 20:56493201-56493223 CTGTTTTTAAAAGGGGCAGGGGG + Intronic
1176242763 20:64082745-64082767 CTGTTTGTCAGAATGGGACAGGG + Intronic
1178564232 21:33668484-33668506 CTGATAGTAAGAAGAGCAAAAGG - Intronic
1178933275 21:36838225-36838247 CTGGTGGCAGGAAGGGCAGAAGG - Intronic
1179141910 21:38733239-38733261 CTGTTTTTAAGAAAGGGAAAAGG - Intergenic
1179910144 21:44443122-44443144 CTGATTCTAAGCAGGGCATAAGG - Intergenic
1181237190 22:21454793-21454815 CTTTTTGGGAGCAGGGCAGAGGG - Intergenic
1181460727 22:23084535-23084557 CTGTCTGCAAGAAGGCCTGATGG - Intronic
1181969235 22:26677779-26677801 CTGTTGGAAAGAAGGTCAGGAGG + Intergenic
1182735448 22:32529606-32529628 CTATTTGTAAAAACAGCAGAAGG - Intronic
1182735677 22:32530965-32530987 CTATTTGTAAGAAGAGCAGAAGG + Intronic
1183852477 22:40602427-40602449 CTGTTTGTAATATTGGCAGATGG - Intronic
1184162350 22:42704541-42704563 CTGTTTGTAAGAAGGGCAGAAGG + Intronic
956269464 3:67434665-67434687 CTGGTTGGGAGAAGGGTAGATGG + Intronic
956587743 3:70882415-70882437 CAGTCTGAAACAAGGGCAGAAGG - Intergenic
956784401 3:72630401-72630423 CTGTTTGGAATAAGGGCAGCTGG - Intergenic
957263252 3:77927590-77927612 CTGTTGGTAAGATGTGCATAAGG - Intergenic
958136883 3:89505250-89505272 CTGTTTGAATGAAGGTAAGATGG + Intergenic
961756954 3:129133835-129133857 CTGTCTTTAAGAAGGAAAGAAGG + Intronic
962258617 3:133888576-133888598 CTCTTGGTAACAAGGCCAGAGGG - Intronic
963873371 3:150444507-150444529 CTGTTGGCAAGAAAGGAAGAAGG + Intronic
964322590 3:155513729-155513751 CTGCATGTTAGAGGGGCAGATGG - Intronic
966154516 3:176901574-176901596 ATGTAGGTAAGAAGGGGAGAAGG + Intergenic
967236899 3:187393789-187393811 ATGCTGGTAAGAAGGGAAGAAGG - Intergenic
967815460 3:193794626-193794648 CTGTCTGTAAAAGGAGCAGATGG + Intergenic
968189078 3:196654452-196654474 CTGTTTGTATTATCGGCAGAAGG - Intronic
969431386 4:7156856-7156878 CTCCTTGTGAGAGGGGCAGAGGG + Intergenic
970289013 4:14551513-14551535 TTGTTTGTAGCAAGGGAAGAAGG - Intergenic
970313197 4:14804390-14804412 CTGATTGTAAAGAGGGCAAAAGG + Intergenic
970463817 4:16303643-16303665 CTGTATATAAGAAGTGAAGATGG - Intergenic
970714266 4:18903031-18903053 CTTTTTGTGAGAATGCCAGAAGG - Intergenic
971843328 4:31884127-31884149 TTATTTGTAAGAAGGTAAGAAGG + Intergenic
972289529 4:37678528-37678550 CTGGTTGTGTAAAGGGCAGAGGG - Intronic
972738064 4:41865032-41865054 CTGGTTGTGAGCAGGGGAGAAGG + Intergenic
974841612 4:67305930-67305952 TTCTATGTAAGAAGGGGAGAAGG - Intergenic
976890808 4:90045230-90045252 GGGTTGGTAGGAAGGGCAGAAGG - Intergenic
977925343 4:102694295-102694317 CTATTTGAAAGAAGAGGAGAGGG - Intronic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
982122259 4:152154566-152154588 CCTTTTCTTAGAAGGGCAGATGG - Intergenic
982677233 4:158389830-158389852 CTATTTGTAATAAGAGAAGATGG - Intronic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
982889936 4:160834574-160834596 GTATTTGGAAGTAGGGCAGAGGG - Intergenic
984356152 4:178661643-178661665 CTTTTTGAAAGAAGGGCTTATGG + Intergenic
986238761 5:5937927-5937949 CTATTTGAAAGCAGGGAAGAGGG - Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
989295553 5:39821623-39821645 CTGTTTGTGACTAGGGAAGATGG + Intergenic
991248454 5:64533040-64533062 CTGTTTGGCAGAAAGGGAGATGG - Intronic
992213168 5:74500782-74500804 CCGTCTGTCAGAAGAGCAGAGGG + Intergenic
992492008 5:77254541-77254563 CCCTTTGTGAGAAAGGCAGAAGG - Intronic
993288179 5:86029450-86029472 ATAATTGTAAGAAGGGCAAAAGG - Intergenic
993820004 5:92602447-92602469 CTGTCTGTAAGACAGGAAGAGGG - Intergenic
994515175 5:100762201-100762223 CTGTTTGGAAGCAGGACAGCTGG - Intergenic
995058057 5:107783666-107783688 AAGTTAGTAAGAATGGCAGAAGG + Intergenic
996796508 5:127353822-127353844 TGGCTTGTAAGAAGGACAGAGGG + Intronic
997619557 5:135276937-135276959 CTGTTTGGAAAGATGGCAGATGG - Intronic
997644194 5:135469234-135469256 CAGTTTGGAAGAAGAGAAGAGGG + Intergenic
1000198605 5:158985837-158985859 GTGTGTGTGAGAAGGGCAGGAGG + Intronic
1000902057 5:166923194-166923216 ATATTTGTAAGCAGGACAGAAGG + Intergenic
1001568845 5:172717251-172717273 CTATTTGTAAGAAGGAAGGAAGG - Intergenic
1001752407 5:174141773-174141795 CTGTCTGTAGGAAGGGCAACTGG + Intronic
1002257168 5:177966487-177966509 CAGTTTGTCAGAAGTGCAGGTGG - Intergenic
1004456742 6:15798448-15798470 CAGTTTGTCAGAAGGGCAGATGG + Intergenic
1005715268 6:28541505-28541527 CTGGTTGTAAGAGGGGAACAGGG + Intergenic
1006315532 6:33289247-33289269 CTGATTGGATGAAGGACAGAGGG - Exonic
1006455989 6:34132216-34132238 GTGCATGGAAGAAGGGCAGAAGG + Intronic
1007122864 6:39397819-39397841 AGGTGTGTAAGAAGGGCTGATGG + Intronic
1009758184 6:67968336-67968358 GTGTTTGTTAAATGGGCAGAGGG + Intergenic
1012936824 6:105376858-105376880 ATCTCTGTAAGAATGGCAGAGGG + Intronic
1017349523 6:153423254-153423276 CTGTCAGTAAGAAAGGAAGATGG - Intergenic
1017677595 6:156829626-156829648 CTGTTTGGTAGAAGGGCAGCAGG + Intronic
1019129410 6:169862727-169862749 CTGTTTGGAACAAGGGCATGGGG - Intergenic
1019285937 7:223128-223150 GTGTTCCTATGAAGGGCAGATGG + Intronic
1020767337 7:12340284-12340306 TTGTATGTAAAAAGGGCAAATGG - Intronic
1021375752 7:19904911-19904933 CTGTTAGTCTGATGGGCAGAAGG + Intergenic
1024521746 7:50310853-50310875 CTGTGTCTCAGAAGGGCAAAGGG - Intronic
1025170734 7:56754270-56754292 CTGCTTGTCAGAAGGGTTGAAGG + Intergenic
1025506797 7:61444511-61444533 CTGTTTGTAAGATCTGCAAATGG + Intergenic
1025701149 7:63821429-63821451 CTGCTTGTCAGAAGGGTTGAAGG - Intergenic
1026170405 7:67949073-67949095 CTGCTTGTCAGAAGGGTTGAAGG - Intergenic
1026459504 7:70601118-70601140 CTGCTTGTAAGAATGTCAAATGG - Intronic
1026484194 7:70803930-70803952 CTGATTTTAAGATGGGCAAAAGG + Intergenic
1027724790 7:81790285-81790307 GAGTTTCAAAGAAGGGCAGAGGG + Intergenic
1029465619 7:100722873-100722895 CTTTCTGTAAGAAGGGGAGAAGG + Intronic
1032408484 7:131675130-131675152 GTGTGTGTAAGATGGGCAGGAGG - Intergenic
1033438623 7:141357710-141357732 CTGTAAGTAACAAGGGCTGATGG - Intronic
1035642091 8:1191571-1191593 TTCTATGTAAGAAGTGCAGAGGG - Intergenic
1035922824 8:3696191-3696213 CTGTCTGTTTGAAGGGCATATGG - Intronic
1036920646 8:12851156-12851178 CTGTTTGAAAGTAGGGGACAAGG - Intergenic
1037202691 8:16276980-16277002 TTGTTTGTTAGAAGTGCAGAAGG - Intronic
1037870096 8:22486216-22486238 TTGTTTGTAAGGAAGACAGAGGG - Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038765572 8:30424617-30424639 CTGTTTGTAAGAAGAGAATGAGG + Intronic
1041179075 8:55229163-55229185 CTGTTTGTAAGGCAGGCAGCAGG + Intronic
1043059440 8:75481362-75481384 CTACTAGTAAGAAGAGCAGATGG - Intronic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1045743621 8:105390206-105390228 CTGTTAGTCAGAAGTGCAGTTGG - Intronic
1045870109 8:106916894-106916916 CTATTTTTAAGAATGGAAGAAGG - Intergenic
1047605968 8:126474733-126474755 GTGTTTGTGAGAAGGCCAGTTGG + Intergenic
1049953130 9:664989-665011 CTGATTTTAAAAAGGGCAAAAGG - Intronic
1050511947 9:6405672-6405694 CACTTTGTAAGAAGAGCACATGG - Intergenic
1052609307 9:30750319-30750341 CTGGTTATGAGCAGGGCAGAGGG + Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054970808 9:71084064-71084086 ATTTTTGAAAGAAGGGAAGAAGG + Intronic
1055155644 9:73059720-73059742 CTATTTTAAAGAAAGGCAGAAGG + Intronic
1056300165 9:85232120-85232142 CTGTGTGTTGGAAGGACAGAGGG + Intergenic
1056571411 9:87819592-87819614 CTGTTTGTAAGAAGGAAGGAAGG - Intergenic
1056969527 9:91190922-91190944 CTGTTTGTAAAAGGGGCTGGGGG - Intergenic
1057131413 9:92656815-92656837 CGCTTTGGGAGAAGGGCAGACGG - Intronic
1057698415 9:97344285-97344307 CTGTATGTAACATGGGCAGGAGG + Intronic
1057838938 9:98469544-98469566 CTGTATGAGAGAAAGGCAGAGGG - Intronic
1059185792 9:112269398-112269420 CTGTTTTTAAAAAGGGTAAAAGG - Intronic
1059246913 9:112856558-112856580 CTGGTTGAGAGAAGAGCAGAGGG + Intronic
1060806955 9:126583738-126583760 CAGCTGGGAAGAAGGGCAGACGG + Intergenic
1060842787 9:126806887-126806909 CTGATTCCAAGAAAGGCAGAGGG - Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1061782983 9:133006799-133006821 CTTTTTGTCAGATGGACAGATGG + Intergenic
1061787271 9:133037348-133037370 CTGCCTGTAAGAAAGTCAGATGG - Intronic
1185529736 X:807853-807875 TTATTTGTAAGAAAGGAAGAAGG - Intergenic
1187293940 X:17981016-17981038 GTGTTAGGGAGAAGGGCAGAAGG - Intergenic
1187623411 X:21084470-21084492 GTGTTTATAAGAAGGGGAGAAGG - Intergenic
1188564177 X:31506602-31506624 ATCTTTGTAAAAAGGGCAGAGGG - Intronic
1193843248 X:86435816-86435838 TTATTTGTAAAAAGGGGAGACGG - Intronic
1194759321 X:97775781-97775803 CTGTTAATAAGAAAGGCAGCTGG - Intergenic
1196773975 X:119321997-119322019 CTTATTGTAAGATGGGCAAATGG - Intergenic
1197829271 X:130624427-130624449 CAGACTGTAAGAAGGCCAGAGGG + Exonic
1198804617 X:140481515-140481537 CTGTGTGTAAGAAGGGAGGGAGG + Intergenic
1199149744 X:144416378-144416400 CTGAATGAAAGCAGGGCAGAAGG - Intergenic
1199732659 X:150651807-150651829 CTGTTTGTATTCAGGGCAGGAGG + Intronic
1199768644 X:150959113-150959135 CTGTTAGTACCAAGGCCAGAGGG + Intergenic