ID: 1184164265

View in Genome Browser
Species Human (GRCh38)
Location 22:42718563-42718585
Sequence CTGGAAAAACGTGTTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 229}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184164257_1184164265 18 Left 1184164257 22:42718522-42718544 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG 0: 1
1: 0
2: 0
3: 23
4: 229
1184164255_1184164265 21 Left 1184164255 22:42718519-42718541 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG 0: 1
1: 0
2: 0
3: 23
4: 229
1184164251_1184164265 30 Left 1184164251 22:42718510-42718532 CCGCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG 0: 1
1: 0
2: 0
3: 23
4: 229
1184164253_1184164265 27 Left 1184164253 22:42718513-42718535 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG 0: 1
1: 0
2: 0
3: 23
4: 229
1184164261_1184164265 -10 Left 1184164261 22:42718550-42718572 CCACCTCGCCCGGCTGGAAAAAC 0: 1
1: 0
2: 13
3: 130
4: 878
Right 1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG 0: 1
1: 0
2: 0
3: 23
4: 229
1184164258_1184164265 17 Left 1184164258 22:42718523-42718545 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG 0: 1
1: 0
2: 0
3: 23
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184164265 Original CRISPR CTGGAAAAACGTGTTTTTAA AGG Intronic
900046448 1:510357-510379 CTAAAAAAAAATGTTTTTAAAGG - Intergenic
902218940 1:14952439-14952461 CTATAAAAATGAGTTTTTAATGG + Intronic
904817991 1:33220010-33220032 CTGGAAAAATGGGTTTCTGATGG + Intergenic
905005266 1:34704620-34704642 CTGGAAAAACTTGAGTTTAAGGG - Intergenic
906477230 1:46177693-46177715 CTGGAAATACGTGTGTTGGACGG + Intronic
907451606 1:54549045-54549067 CAGGAAAAGCCTTTTTTTAAAGG + Intronic
908324583 1:63011151-63011173 CAGGACAAATGTGTTTTCAATGG - Intergenic
908491422 1:64648041-64648063 TTGGATAAACGTCATTTTAAAGG + Intronic
908863135 1:68512967-68512989 CTCAAAAAAAGTGTTCTTAAAGG - Intergenic
909130528 1:71730111-71730133 TTGTAAAAACCAGTTTTTAAAGG - Intronic
913566290 1:120075803-120075825 CTGGAAACAGGTATTTATAATGG + Intergenic
913631840 1:120717748-120717770 CTGGAAACAGGTATTTATAATGG - Intergenic
914286878 1:146235159-146235181 CTGGAAACAGGTATTTATAATGG + Intergenic
914547910 1:148685902-148685924 CTGGAAACAGGTATTTATAATGG + Intergenic
914618599 1:149384443-149384465 CTGGAAACAGGTATTTATAATGG - Intergenic
916771654 1:167914665-167914687 CTGGAAAAATGTATTTTAAGAGG + Intergenic
918648033 1:186924734-186924756 CTAGAAAAACGTATTTCTCATGG - Intronic
919923637 1:202180894-202180916 TTAAAAAAAAGTGTTTTTAATGG - Intergenic
921613702 1:217242304-217242326 CTGGAATATCTTGTTTTTCATGG + Intergenic
921848750 1:219911689-219911711 CTTTAAAAACATATTTTTAAAGG - Intronic
921863775 1:220067080-220067102 CTGGGAATCCGTATTTTTAAAGG + Intronic
921989187 1:221345957-221345979 CTAAAAAAACATATTTTTAAAGG - Intergenic
1063920077 10:10923932-10923954 CTTGAAAAACATGATTGTAACGG - Intergenic
1063938316 10:11101972-11101994 TTGTAAAAATGTGTTTTTAAGGG + Intronic
1064147245 10:12835307-12835329 TTGGACAAACATGTTTTTATGGG - Exonic
1069830852 10:71281638-71281660 CTAGAAAAAGGAATTTTTAAGGG + Intronic
1070496207 10:77025853-77025875 GTGGAAAAAGGTGTGTTTGAGGG - Intronic
1071106609 10:82105109-82105131 CTAGAAAAACGTGAATTCAATGG + Intronic
1071130100 10:82380677-82380699 CGGGAAAAACATATTTTTGAGGG + Intronic
1071917747 10:90314809-90314831 CTGAAAAAACATGTTTTGAATGG - Intergenic
1077294186 11:1816712-1816734 CTGGAAATATATATTTTTAAAGG - Intergenic
1078061751 11:8051332-8051354 CGGGAAAATACTGTTTTTAATGG + Intronic
1078241335 11:9533220-9533242 CAGGAAAAACTTGCTTTTAAAGG - Intergenic
1078402670 11:11042213-11042235 ATTAAAAAACGTTTTTTTAATGG + Intergenic
1079227011 11:18615342-18615364 CACGACAAACCTGTTTTTAATGG - Exonic
1081491610 11:43573830-43573852 CAGGCTAAACATGTTTTTAAAGG - Intronic
1085180609 11:74532679-74532701 CTGGAAAAACATGTTTCACAGGG - Intronic
1087676774 11:101172345-101172367 TTGGCAAAACTTGTTTTCAAAGG - Intergenic
1087707509 11:101511624-101511646 GTTGAAAGCCGTGTTTTTAATGG + Intronic
1090514955 11:127415186-127415208 TTGGATAAACATTTTTTTAAGGG + Intergenic
1090962729 11:131571630-131571652 CTGGAAAAACGTTGTGTTTAGGG + Intronic
1091873298 12:3912918-3912940 CTTGTAAAATGTGTTTTAAAAGG - Intergenic
1092564384 12:9648754-9648776 TTGGGGAAACTTGTTTTTAAGGG + Intergenic
1093044829 12:14431097-14431119 GTAGAAAACTGTGTTTTTAAAGG - Intronic
1093092092 12:14933461-14933483 CTGGATAAATGTAGTTTTAATGG + Intronic
1099450374 12:82800789-82800811 CAGGAAAAATGTGTTTCTATAGG - Intronic
1101466133 12:104951083-104951105 CTCTAAAAAAGTATTTTTAATGG + Intronic
1101670539 12:106867842-106867864 GGGGAAAAATGTCTTTTTAAAGG + Intronic
1101676317 12:106920025-106920047 CTATAAGAACCTGTTTTTAAAGG - Intergenic
1104085175 12:125467723-125467745 CTGGATATAGGTGTTTTTACAGG - Intronic
1105266106 13:18817274-18817296 CTTGAAATACTTGTATTTAAAGG + Intergenic
1106083251 13:26517921-26517943 CTGGAATAACATGTTATTATGGG + Intergenic
1106701327 13:32232411-32232433 CTGGAAACACGTGTTAGTCAGGG + Intronic
1106782958 13:33078173-33078195 CTGGAACAAGATATTTTTAAAGG + Intergenic
1107611198 13:42114874-42114896 GGGGAAAAAGGTGTTTTTAGTGG - Intronic
1109017007 13:57029629-57029651 CTGAAACAACCTTTTTTTAAGGG + Intergenic
1109474597 13:62862859-62862881 CTGGAAAACAGTGTCATTAAAGG - Intergenic
1109779454 13:67088665-67088687 CAGGGAAAACGTGTGTTTAATGG + Intronic
1109779828 13:67094498-67094520 ATGCAAATACGTGTTTCTAAGGG - Intronic
1111105047 13:83634186-83634208 ATGGAGTAATGTGTTTTTAAAGG + Intergenic
1112451427 13:99514562-99514584 TTGGAGAAACGTGTTATTAGGGG - Intronic
1112605016 13:100896066-100896088 CTGAACAAACTTGTTTTTGAAGG - Intergenic
1112730706 13:102358044-102358066 CAGGAAAATCTTATTTTTAATGG + Intronic
1113056610 13:106274907-106274929 ATGGAAAAAAGTATCTTTAATGG - Intergenic
1115278316 14:31632539-31632561 CTTGAAACACCTGTTTCTAAAGG - Intronic
1117047914 14:51831244-51831266 TTGGCAAAAAATGTTTTTAAAGG - Intronic
1117783468 14:59258341-59258363 CTGGAAAATCAAGTTGTTAAGGG + Intronic
1118271182 14:64343777-64343799 GTAGAAAAATGTGTTTTTAGGGG - Intergenic
1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG + Intronic
1118853009 14:69599242-69599264 CAGGAAAAAAGTGTTGCTAAAGG - Intergenic
1119963752 14:78889782-78889804 CTGGGAACACATGTTTTTAGGGG - Intronic
1120510506 14:85408015-85408037 CTGGTGAAAAGTATTTTTAAAGG + Intergenic
1121906534 14:97751208-97751230 CAGGAAAAAAGTATTATTAAAGG + Exonic
1122191712 14:100050128-100050150 CTGGAAAAAAATGTTTTTACGGG - Intronic
1123848318 15:24327121-24327143 CTGGAAAAATGAGTTTAAAAAGG + Intergenic
1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG + Intergenic
1124187897 15:27545841-27545863 CTAGAAACACGTGCTTTTACTGG + Intergenic
1125506593 15:40271156-40271178 CAGGGATTACGTGTTTTTAAAGG - Intronic
1125818580 15:42608071-42608093 CTGGACAAAGGTGTTTCTCAAGG - Intronic
1126745783 15:51825075-51825097 ATGTAAAAACGTGTATTTATAGG - Intergenic
1128022656 15:64405990-64406012 TTGAAAAAACGTATATTTAAAGG + Intronic
1128279810 15:66385786-66385808 CTGGATGAAAGTTTTTTTAAAGG + Intronic
1130702200 15:86195712-86195734 TTGGCAAAACGTGGTTTAAATGG + Intronic
1131446242 15:92500121-92500143 CTATAAAAACGTCTTTTGAAAGG + Intronic
1131650960 15:94399272-94399294 CTGGTAAAACCTGAGTTTAATGG + Intronic
1132017359 15:98330660-98330682 GTGGAAAACCGGGTATTTAAGGG + Intergenic
1134201292 16:12201615-12201637 CTGGAAAGAGGTATATTTAATGG - Intronic
1135849696 16:25952204-25952226 CTGGAAAACTGTTTCTTTAAAGG - Intronic
1137244537 16:46691380-46691402 TTGGAAATACGTGCTTTAAAAGG - Intronic
1138132052 16:54488642-54488664 CTACAAAAACGAGATTTTAAGGG + Intergenic
1139296212 16:65903325-65903347 ATAGAAAAACATCTTTTTAAAGG - Intergenic
1141405397 16:83788249-83788271 CTGGAAATGAGTGTTTTAAATGG + Intronic
1141730966 16:85822599-85822621 CTGGAAATACCCGGTTTTAAAGG + Intergenic
1142447475 16:90150692-90150714 CTAAAAAAAAATGTTTTTAAAGG + Intergenic
1143000247 17:3789845-3789867 CATGAAAAACGTCTTTTTTATGG + Intronic
1146431785 17:32803472-32803494 CTGGAAATATGTATTTTAAAAGG + Intronic
1150045982 17:61913667-61913689 CTGGAAAAATATATTTTCAAAGG - Intronic
1151063263 17:71121369-71121391 CTGAATAAATGAGTTTTTAAAGG + Intergenic
1152448715 17:80362836-80362858 CTTGAAAAACATGGTTTTAATGG - Intronic
1152494590 17:80662018-80662040 CTGGAAAAAAGTTTTTAGAAAGG - Intronic
1155050554 18:22143792-22143814 CTTCAAAGACATGTTTTTAATGG + Intergenic
1158313901 18:56189465-56189487 CTGCAAAACCATGTTTTGAACGG - Intergenic
1158824130 18:61195234-61195256 CTGGAAAAATATTTTTTTAAAGG - Intergenic
1159546105 18:69840880-69840902 CCAGAAAAAGCTGTTTTTAATGG - Intronic
1160603253 18:80030667-80030689 CTGGCCAAGAGTGTTTTTAATGG - Intronic
1164222513 19:23207792-23207814 CTGCTAAACCATGTTTTTAAAGG + Intergenic
1165703232 19:37954575-37954597 CTTGAAAACAGTGTTTTCAAGGG - Intronic
1167303067 19:48690688-48690710 CTCAAAAAAAATGTTTTTAAAGG - Intergenic
926484359 2:13436736-13436758 CTGGGAGAATATGTTTTTAAAGG + Intergenic
928515709 2:32043171-32043193 CAGGAACAACATGTTTTAAATGG - Intergenic
929196886 2:39193890-39193912 CTGTAAAAATATATTTTTAAAGG - Intronic
929481977 2:42317574-42317596 ATGTAAAAATTTGTTTTTAACGG - Intronic
932208963 2:69911265-69911287 TTGCAAAACAGTGTTTTTAAAGG + Intronic
934894563 2:98102937-98102959 TTGGAAAATTGTGTTTTTCAAGG + Intronic
935236825 2:101145805-101145827 CAGGAGAAAGGTGTTTTTATAGG - Intronic
935449100 2:103189323-103189345 CTGGAAAAACCCGTGTTTAAAGG + Intergenic
936863367 2:117048799-117048821 CTCAAAAATAGTGTTTTTAACGG + Intergenic
937718219 2:125059833-125059855 CAACAAAAAAGTGTTTTTAAAGG - Intergenic
939191020 2:138916906-138916928 CTGGTAATACGTGGTATTAAAGG + Intergenic
940085805 2:149857161-149857183 ATGAAGAAACATGTTTTTAAGGG + Intergenic
941542685 2:166806090-166806112 CTGGGAAAATGTGTTATGAAGGG - Intergenic
942075350 2:172352273-172352295 CTGGGAGAAAGTATTTTTAAAGG - Intergenic
942569190 2:177296079-177296101 GTGGAAATACATGTTTTTTAGGG + Intronic
943270165 2:185790791-185790813 CTGTCAAACCATGTTTTTAATGG - Exonic
946804136 2:223452922-223452944 CTTGAAATACCTGTTTTGAAGGG + Intergenic
946976986 2:225164099-225164121 ATGGAAATTCGTGTTTTGAAAGG - Intergenic
947563827 2:231181096-231181118 CTGGAGAAATCTGTTTTTCAGGG - Intergenic
1173077963 20:39838935-39838957 CTAGAAAAACATGTTTCTAGAGG + Intergenic
1174495222 20:50936209-50936231 ATAGAAAAATGTGTTTCTAAAGG - Exonic
1174564674 20:51456427-51456449 CTGGAGAAACCTGCTTTTGAGGG - Intronic
1174716952 20:52769150-52769172 AAGGAAAAACGTGTTTTTATGGG + Intergenic
1175200791 20:57276119-57276141 CTGGAAAAAATTGTTTTTTAGGG - Intergenic
1176851175 21:13915746-13915768 CTTGAAATACTTGTATTTAAAGG + Intergenic
1178495950 21:33086311-33086333 CTGGACATGCCTGTTTTTAAAGG - Intergenic
1178993060 21:37370938-37370960 CTGGTAAAAAGTCTTTTAAAAGG - Intronic
1179030788 21:37717960-37717982 CTGGAAGAACCTGTTTTGAAAGG + Intronic
1183162298 22:36123123-36123145 CTGGACAAAAGAGTTTTGAATGG - Intergenic
1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG + Intronic
1184448756 22:44570451-44570473 CTGGTAACACCTATTTTTAAGGG + Intergenic
1184847234 22:47096417-47096439 CTGGAAAAAGGTATTTGTAGTGG - Intronic
1185400358 22:50612477-50612499 CTGTGAAGACGTGTTTTTTACGG - Intronic
1185429192 22:50795581-50795603 CTCGAAAAAAATTTTTTTAAAGG - Intergenic
949122326 3:401564-401586 CTGGTAAAATGTCTTTTAAATGG + Intronic
949155738 3:825876-825898 CTCCAAAAACATGTTTTAAATGG + Intergenic
951995936 3:28728873-28728895 CTGGTTAAACCTGTGTTTAATGG + Intergenic
955487130 3:59446664-59446686 CTGGAAATAGATGTTTTTAAAGG + Intergenic
956342758 3:68245076-68245098 TAGAAAAAACGTATTTTTAAGGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
957114449 3:76007000-76007022 CTGGAAATACCAGTTTTTAAGGG + Intronic
957460660 3:80514886-80514908 ATGAAAAAATGTGTTTTGAAAGG + Intergenic
957581679 3:82081156-82081178 CTTTAAAAATATGTTTTTAAAGG - Intergenic
958878201 3:99639136-99639158 CTGGAAAGATATTTTTTTAAAGG - Intronic
963095538 3:141535350-141535372 CTGGTAAAAAATGTTTTTACAGG - Intronic
963985542 3:151589683-151589705 CTAGAAAAAAGGGTTTTTGATGG + Intergenic
966276667 3:178181179-178181201 TTGGAAAAAAGTGGTTTAAATGG - Intergenic
966526935 3:180929812-180929834 CTAGACAAAGGTGTTTCTAATGG - Intronic
968373528 4:17595-17617 CTCAAAAAAAATGTTTTTAAAGG + Intergenic
970253653 4:14144140-14144162 CAGGAAGCACTTGTTTTTAAAGG + Intergenic
972951801 4:44335061-44335083 CTGGCAAAACGTTTTTTAAATGG + Intronic
974431122 4:61797338-61797360 CTACAAAAAGGTGTTTCTAAAGG + Intronic
974478139 4:62409746-62409768 CTGGAAAATCTTATTTTGAATGG - Intergenic
975554041 4:75642068-75642090 ATGGAAAAACATTTTTTAAAGGG - Intergenic
975664903 4:76725993-76726015 CTTCAAAAACCTGTTTCTAAAGG - Intronic
975773786 4:77760444-77760466 ATGGAAAAACCAGTTTTTAGAGG + Intronic
975957905 4:79864264-79864286 TTGGGAAAACATGTTTTTAAAGG + Intergenic
977324607 4:95559160-95559182 CTGGAAAAAATTTTTTTTAAAGG + Intergenic
978855418 4:113388703-113388725 CTGGAAAAATATATTTATAAAGG + Intergenic
982244475 4:153336786-153336808 CTGGAAAAACCTTTTTTCAGAGG - Exonic
982725776 4:158904100-158904122 CTGGAAGAATGAGTTTATAATGG + Intronic
983180674 4:164644719-164644741 CTGGAGAAATGTGTTTTACATGG - Intergenic
983223063 4:165061206-165061228 CTGGAAAATCTTGTTACTAATGG + Intergenic
984689524 4:182709283-182709305 CTGGAAAATAGTTTTTTTAATGG + Intronic
985215883 4:187653193-187653215 CTGTTAAAATATGTTTTTAAAGG + Intergenic
985461865 4:190114956-190114978 CTCAAAAAAAATGTTTTTAAAGG - Intergenic
987807731 5:22792042-22792064 CTGCAAAAAAGTGCTTATAAAGG - Intronic
988168782 5:27628438-27628460 ATGGAAAAATATGATTTTAATGG + Intergenic
988303885 5:29469566-29469588 CAGGGAAAACCTGTTTTAAAAGG - Intergenic
989287035 5:39713174-39713196 CTGAATAAACCTTTTTTTAAAGG + Intergenic
989300375 5:39884607-39884629 CTAGAGAAAACTGTTTTTAAAGG - Intergenic
989563178 5:42874306-42874328 CTGGACAAATTTTTTTTTAACGG + Intronic
989640884 5:43581877-43581899 CTGGAAAAATGGGCTTATAAAGG + Intergenic
989804781 5:45589688-45589710 ATGGCAATACATGTTTTTAATGG + Intronic
990846366 5:60144538-60144560 CTGGAAAAAAATCTTTTTAATGG - Intronic
990943090 5:61223341-61223363 TTGGAAAAACATGTTTTAAAAGG + Intergenic
993951327 5:94179412-94179434 CTGGAAAGAAGTGTTTTGACTGG + Intronic
995002137 5:107146397-107146419 ATATAAATACGTGTTTTTAAAGG + Intergenic
995650802 5:114365202-114365224 TTTGAAAAATGTGTTTTTGAAGG + Intronic
997607762 5:135187508-135187530 ATGGAAAAATGTACTTTTAATGG - Intronic
998310973 5:141131019-141131041 TCGGAAAATTGTGTTTTTAAAGG - Intronic
1000287409 5:159838461-159838483 CTGGAAAAAGGGGCTTTGAAGGG + Intergenic
1001652339 5:173324777-173324799 GAGGAAAGACGTGTATTTAAGGG - Intronic
1004560084 6:16741299-16741321 CTGGATAACTGTGGTTTTAAAGG + Intronic
1005027307 6:21475571-21475593 CTAGAAAAAAGTGTCATTAAAGG - Intergenic
1005058452 6:21753387-21753409 CTGGAATAAAGTGTTTCTGATGG + Intergenic
1008453806 6:51685053-51685075 CTGGAAAATCATGTATTTCAGGG - Intronic
1010497778 6:76556263-76556285 TTGAAAAAACATGTTTTTCAAGG + Intergenic
1010688659 6:78881661-78881683 CTGGAAAATGGTGTTTTGACTGG + Intronic
1011661713 6:89600473-89600495 CTGGAAAAAGTTGTTTTTATTGG + Intronic
1013051547 6:106540305-106540327 CTTCAAAAACATGTTTGTAATGG - Intronic
1013257499 6:108402772-108402794 CTGGGAAAACATGTTAATAATGG - Intronic
1013381209 6:109573167-109573189 CAGGAAAAAAGTGTCATTAAAGG - Intronic
1014051236 6:116957511-116957533 CTTTAAAAACTTGTTTTAAATGG - Intergenic
1017259782 6:152372406-152372428 CTGCCAAAAAGTGTTTTAAAAGG + Intronic
1019388144 7:770266-770288 ATGGAAAAACGTGATTTTGGGGG + Intronic
1025588664 7:62826598-62826620 CTGGAAAACTGTTTTTTGAAGGG + Intergenic
1026449803 7:70518380-70518402 CTAGAAAAACGTGTCTTTTTGGG + Intronic
1028274707 7:88840365-88840387 CTGGATAAATATGTTTTAAATGG + Intronic
1029026641 7:97423732-97423754 CTGAGAAAATGTGTTTATAAGGG - Intergenic
1030667515 7:112296309-112296331 CTGGTAAGAATTGTTTTTAAAGG + Exonic
1030866567 7:114707656-114707678 CTGCAAAAATGTGTTTTTAGAGG + Intergenic
1031147014 7:118007702-118007724 CTGCAAAAATGTGTTTTCACTGG - Intergenic
1033257196 7:139812381-139812403 CTGGAAAAACGTTTGGTTCAGGG - Intronic
1033387699 7:140894478-140894500 ATGGAAAAAAATTTTTTTAATGG + Intronic
1033396452 7:140978655-140978677 CTGGAAGAAAGTGTTTCCAAAGG - Intergenic
1035238780 7:157517002-157517024 CTGGAAATCAGGGTTTTTAATGG - Intergenic
1036414373 8:8533381-8533403 CTTTAAAAATGTATTTTTAAAGG + Intergenic
1037389069 8:18373863-18373885 CTGGGAGAAAGTGTCTTTAATGG + Intergenic
1038092957 8:24274858-24274880 ATGGGAAAAAATGTTTTTAAAGG - Intergenic
1040019727 8:42730057-42730079 CTGGGAAAACATTTTTTTATTGG + Intronic
1041814203 8:61949700-61949722 CTGGTATAACTTATTTTTAAAGG + Intergenic
1042658051 8:71122207-71122229 TTGGCAAATCGTGTTTTTCATGG + Intergenic
1042845010 8:73160914-73160936 CTGGAAAAACGTAGTTTCAGCGG - Intergenic
1043779790 8:84317636-84317658 CTGTCAAAACTTGTTTTTACAGG - Intronic
1045847145 8:106650830-106650852 CTTGAGAAAAGTATTTTTAAGGG - Intronic
1047556561 8:125938422-125938444 CTAGAAATATGTGCTTTTAAGGG + Intergenic
1048222643 8:132556102-132556124 CATGAAATACATGTTTTTAAAGG - Intergenic
1048225075 8:132577314-132577336 CTGGAAGAAGGTGTTTTTGTAGG - Intronic
1048730122 8:137430313-137430335 CTTGCAAAACATGTATTTAAGGG - Intergenic
1051995594 9:23212657-23212679 AAAGAAAAATGTGTTTTTAAAGG - Intergenic
1052421592 9:28250018-28250040 CATGAAAAACCTGTTTATAAAGG + Intronic
1052593283 9:30526804-30526826 CTGGAAAAATGTTTTGATAATGG + Intergenic
1054873660 9:70073239-70073261 CTGAAAATACGTGGTTTAAAAGG + Intronic
1055255590 9:74366645-74366667 CTAAAAAAAAGTATTTTTAAAGG - Intergenic
1056014372 9:82367438-82367460 TTGGAAAAACGTATTAATAATGG - Intergenic
1056691174 9:88809822-88809844 TTGGAAAAACATGATTTAAATGG + Intergenic
1057690857 9:97283598-97283620 CAGGGAAAACGTGTTTGGAAGGG - Intergenic
1057750800 9:97791229-97791251 CAGGAAAAAAGTGTGTTTCAGGG + Intergenic
1058568493 9:106313251-106313273 ATGGAAAAAACTGTTTTTGATGG + Intergenic
1061351987 9:130072634-130072656 CTTCAAAAACCTGTTTTTCATGG + Intronic
1061766500 9:132884813-132884835 CCAGAAAAAAATGTTTTTAAAGG - Intronic
1203574970 Un_KI270745v1:476-498 CTAAAAAAAAATGTTTTTAAAGG + Intergenic
1185744006 X:2556811-2556833 TTAGAGAAACGTGTGTTTAAAGG - Intergenic
1187518887 X:19996238-19996260 CTGGACAACAGTGTTTTCAAGGG - Intergenic
1188543613 X:31277350-31277372 CAGTAAAAAAGTGTTTTAAAAGG + Intronic
1194753337 X:97708171-97708193 CTGCAAAACCTTATTTTTAAGGG - Intergenic
1195783457 X:108489517-108489539 GTGGAAAAACGTTTTTTAAAAGG - Intronic
1197238257 X:124092904-124092926 CTGGACAAATATGTTTATAATGG - Intronic
1198201718 X:134427083-134427105 CTTGACAAACGTGATCTTAAGGG - Exonic
1198913715 X:141642174-141642196 CTGAAAAAATATTTTTTTAAAGG - Intronic
1199210552 X:145205005-145205027 TTGAAAAAAAGTATTTTTAATGG + Intergenic
1200279564 X:154765030-154765052 AAGGAAAGAAGTGTTTTTAAAGG + Intronic
1200327431 X:155256654-155256676 CTGGACAAACGTGGTATCAATGG + Intergenic
1202060544 Y:20883281-20883303 CCAGTAAAAGGTGTTTTTAAGGG - Intergenic