ID: 1184164707

View in Genome Browser
Species Human (GRCh38)
Location 22:42720567-42720589
Sequence CGCCCCGAAGTGGAGCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184164707_1184164716 -2 Left 1184164707 22:42720567-42720589 CCGCCGCGCTCCACTTCGGGGCG No data
Right 1184164716 22:42720588-42720610 CGCAGTTGGGGTGGAGGCGGTGG 0: 1
1: 0
2: 2
3: 44
4: 541
1184164707_1184164720 16 Left 1184164707 22:42720567-42720589 CCGCCGCGCTCCACTTCGGGGCG No data
Right 1184164720 22:42720606-42720628 GGTGGCCGGGACCGCCGCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 186
1184164707_1184164718 3 Left 1184164707 22:42720567-42720589 CCGCCGCGCTCCACTTCGGGGCG No data
Right 1184164718 22:42720593-42720615 TTGGGGTGGAGGCGGTGGCCGGG 0: 1
1: 1
2: 2
3: 69
4: 606
1184164707_1184164715 -5 Left 1184164707 22:42720567-42720589 CCGCCGCGCTCCACTTCGGGGCG No data
Right 1184164715 22:42720585-42720607 GGGCGCAGTTGGGGTGGAGGCGG 0: 1
1: 0
2: 3
3: 71
4: 701
1184164707_1184164714 -8 Left 1184164707 22:42720567-42720589 CCGCCGCGCTCCACTTCGGGGCG No data
Right 1184164714 22:42720582-42720604 TCGGGGCGCAGTTGGGGTGGAGG 0: 1
1: 0
2: 0
3: 36
4: 239
1184164707_1184164721 17 Left 1184164707 22:42720567-42720589 CCGCCGCGCTCCACTTCGGGGCG No data
Right 1184164721 22:42720607-42720629 GTGGCCGGGACCGCCGCGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 166
1184164707_1184164719 15 Left 1184164707 22:42720567-42720589 CCGCCGCGCTCCACTTCGGGGCG No data
Right 1184164719 22:42720605-42720627 CGGTGGCCGGGACCGCCGCGCGG 0: 1
1: 0
2: 1
3: 12
4: 156
1184164707_1184164717 2 Left 1184164707 22:42720567-42720589 CCGCCGCGCTCCACTTCGGGGCG No data
Right 1184164717 22:42720592-42720614 GTTGGGGTGGAGGCGGTGGCCGG 0: 1
1: 2
2: 9
3: 141
4: 1025

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184164707 Original CRISPR CGCCCCGAAGTGGAGCGCGG CGG (reversed) Intronic
No off target data available for this crispr