ID: 1184166787

View in Genome Browser
Species Human (GRCh38)
Location 22:42734084-42734106
Sequence CACTTCAACCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184166784_1184166787 2 Left 1184166784 22:42734059-42734081 CCTGTAGAGGCTGAGGCAGGAGA 0: 5
1: 37
2: 331
3: 2595
4: 3034
Right 1184166787 22:42734084-42734106 CACTTCAACCCAGGAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184166787 Original CRISPR CACTTCAACCCAGGAGACGG AGG Intergenic
No off target data available for this crispr