ID: 1184167257

View in Genome Browser
Species Human (GRCh38)
Location 22:42737169-42737191
Sequence CAAAGCAACCACTTCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184167257_1184167263 14 Left 1184167257 22:42737169-42737191 CCAAATTTGAAGTGGTTGCTTTG No data
Right 1184167263 22:42737206-42737228 TACTTCCCCATTACTAGTTTTGG No data
1184167257_1184167264 15 Left 1184167257 22:42737169-42737191 CCAAATTTGAAGTGGTTGCTTTG No data
Right 1184167264 22:42737207-42737229 ACTTCCCCATTACTAGTTTTGGG No data
1184167257_1184167261 -10 Left 1184167257 22:42737169-42737191 CCAAATTTGAAGTGGTTGCTTTG No data
Right 1184167261 22:42737182-42737204 GGTTGCTTTGGATGGGAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184167257 Original CRISPR CAAAGCAACCACTTCAAATT TGG (reversed) Intergenic
No off target data available for this crispr