ID: 1184177660

View in Genome Browser
Species Human (GRCh38)
Location 22:42798251-42798273
Sequence CTGAGGGAACTCTCCGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184177656_1184177660 -9 Left 1184177656 22:42798237-42798259 CCAGAGTCCTGGGGCTGAGGGAA 0: 1
1: 0
2: 8
3: 75
4: 400
Right 1184177660 22:42798251-42798273 CTGAGGGAACTCTCCGGAATGGG 0: 1
1: 0
2: 2
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184177660 Original CRISPR CTGAGGGAACTCTCCGGAAT GGG Intronic
900880957 1:5381043-5381065 CTGGGGGTAGTCTCAGGAATGGG - Intergenic
904154827 1:28474027-28474049 CTGTGAGAACCCTCCAGAATAGG - Exonic
905028091 1:34865135-34865157 CTGGGGGAACCCTGCGGACTGGG + Intergenic
905901547 1:41584738-41584760 CTGAGGGAAGTCCCCGGAAGCGG - Exonic
909885177 1:80932679-80932701 ATGTGGGAACTCTCAGGAATTGG - Intergenic
917096474 1:171403726-171403748 CTGAGGCCACTGTCCGGTATGGG - Intergenic
1071365806 10:84899583-84899605 CTGGGGGAACTCTCTGGAATGGG + Intergenic
1073670193 10:105579459-105579481 CTCAGGGAACTCTCAGGTCTGGG + Intergenic
1083999371 11:66287990-66288012 CTGAGGGCACTGTGAGGAATCGG + Intronic
1096982962 12:55738784-55738806 CTGAGGGAACTCAAGGAAATAGG + Intergenic
1098949213 12:76622330-76622352 CTGAAGGAACACACCAGAATAGG - Intergenic
1102193641 12:111008447-111008469 CTGAGGGAACTTTTGGGAAGGGG + Intergenic
1102663989 12:114554330-114554352 ATGAGGTGACTCTCCTGAATGGG - Intergenic
1106123293 13:26879957-26879979 CTGAAGGATTTCTCCAGAATTGG - Intergenic
1106609404 13:31264109-31264131 GGGAGGGAACTCTCATGAATGGG - Intronic
1115342938 14:32311568-32311590 CTGAGGGAACACTGGGGCATAGG - Intergenic
1117330440 14:54706851-54706873 CTGAGGGAACTGCCCCGAAGAGG + Intronic
1125931660 15:43604485-43604507 CTGAGGGAACTGTGAGGAAAAGG + Intronic
1125944764 15:43703965-43703987 CTGAGGGAACTGTGAGGAAAAGG + Intergenic
1135882179 16:26268515-26268537 ATGATGGAACTCTCATGAATGGG - Intergenic
1140321826 16:73959844-73959866 CTTAGGGAACTGGCAGGAATGGG + Intergenic
1141171222 16:81692914-81692936 CACAGGGAACTTTCGGGAATGGG + Intronic
1142494079 17:297037-297059 CTGATGGAACTCTCCGCAGAGGG - Intronic
1143988745 17:10938651-10938673 CTGAGGGAGCTCTCAGGACATGG + Intergenic
1147576672 17:41605292-41605314 CTCTGGAAACTCTCTGGAATAGG + Intergenic
1148666635 17:49379756-49379778 CCGAGGGCCCTCTCCTGAATGGG - Intronic
1155555280 18:27011825-27011847 TTGTGGGAACTCTCCTGAAGAGG - Intronic
1164480197 19:28605809-28605831 CTGAGATAACTCCCCGGAACAGG - Intergenic
925488987 2:4370655-4370677 CTTAGGCAACCCTCTGGAATTGG + Intergenic
928552051 2:32382315-32382337 CTGAGGGAACTCTATGAAACTGG + Intronic
930751990 2:54943281-54943303 GTGAGGGAACTGTCTTGAATAGG - Intronic
931219715 2:60278061-60278083 CTGTGGAAACTCTCAGGACTAGG - Intergenic
931729796 2:65142986-65143008 CTGAGCGATTTCTCTGGAATTGG + Intergenic
934936917 2:98472284-98472306 CTGAGGGAACTCCCAGGAGCAGG - Intronic
936565143 2:113577175-113577197 CTGAGGGGGCTCTCAGGGATGGG - Intergenic
1174696119 20:52560687-52560709 CTGAGGGAACTCTCCTGCTCAGG + Intergenic
1176272489 20:64243357-64243379 CTGAGGGGACACTTCAGAATCGG - Intergenic
1182095006 22:27620186-27620208 CTGAGGGTATTCTGTGGAATAGG - Intergenic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184177660 22:42798251-42798273 CTGAGGGAACTCTCCGGAATGGG + Intronic
1185266113 22:49905119-49905141 CTGAGTGAACTCTCTGGGACAGG + Intronic
954380098 3:50214760-50214782 CTGAGGGCACTCACAGGAAAAGG - Exonic
954465805 3:50654127-50654149 CAGAGTGAACTCTCCAGAAAGGG - Intergenic
955052228 3:55423893-55423915 ATCAGGGAGCCCTCCGGAATTGG - Intergenic
956627707 3:71283019-71283041 CTAAGTGCACTCTCAGGAATGGG + Intronic
956880643 3:73507745-73507767 CTAAAGGAACTCTCAGGTATTGG + Intronic
965378813 3:167961880-167961902 CAGAGGGAGCCCTCCTGAATGGG - Intergenic
966676825 3:182598860-182598882 CTCAGGGAACTCACCAGAAAGGG - Intergenic
974019483 4:56680083-56680105 CTGAGGAACCTCTCCAGAAGTGG - Intronic
974893843 4:67914059-67914081 CTGAGGGAACTCCAAGTAATTGG - Intronic
975973788 4:80072830-80072852 CTGCAGGAACTCTCCGGAATCGG - Intronic
980936200 4:139227993-139228015 CTGAGGGCTGTCTCCAGAATTGG + Intergenic
982405739 4:155018274-155018296 CTGAGAGGACACTCCGTAATTGG + Intergenic
1000106965 5:158069016-158069038 CTGAGGCAAGTCTGCAGAATGGG - Intergenic
1002714270 5:181216666-181216688 CTGGGAGAACTCTCCTGCATGGG + Intergenic
1005870475 6:29971357-29971379 CAGAGGGAACTCTTAGGGATGGG + Intergenic
1005922660 6:30415822-30415844 AGGAGGGAACTCTCTGGGATGGG - Intergenic
1005993646 6:30919014-30919036 CTGAGAGAAGTCTCAGGAAAAGG - Intronic
1006059822 6:31411665-31411687 AGGAGGGAACTCTCCAGGATGGG - Intronic
1006072314 6:31506736-31506758 AGGAGGGAACTCTCCGGGATGGG - Intronic
1006721413 6:36154487-36154509 CTGAGGGTACTCTTCAGAACAGG + Intergenic
1011781792 6:90797693-90797715 GTGAGGCAACTCTGGGGAATTGG + Intergenic
1015558975 6:134494648-134494670 ATGAAGGAACTCACCGGAAAAGG + Intergenic
1019400466 7:849394-849416 CTGTGGGAACTCTGTGGAAGTGG + Intronic
1024261068 7:47574063-47574085 CTGAGGGAACGGTCCAGAACTGG - Intronic
1034754162 7:153598897-153598919 CTGAGGAAACCCTCGGGAAAAGG - Intergenic
1039835062 8:41249504-41249526 CTGAGGGAACTTCCCAGACTGGG - Intergenic
1050712274 9:8478747-8478769 GTGAGGGAACTCTCCTGATGTGG + Intronic
1057831784 9:98412791-98412813 CGCAGGGCTCTCTCCGGAATGGG - Intronic
1203446011 Un_GL000219v1:57039-57061 CTGAGGGAACTGTCTAGCATTGG + Intergenic
1189901892 X:45714977-45714999 CTGAGGAAGCCCTCCGGAAGTGG + Intergenic
1196749442 X:119101622-119101644 GTGCAGGAACTCTCAGGAATGGG - Intronic
1200904766 Y:8470596-8470618 GTGAGGGCACTCTCCAGCATTGG + Intergenic