ID: 1184178124

View in Genome Browser
Species Human (GRCh38)
Location 22:42801399-42801421
Sequence CAGCAAACATCAGTTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 229}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184178124_1184178130 -2 Left 1184178124 22:42801399-42801421 CCACCCACAACTGATGTTTGCTG 0: 1
1: 0
2: 3
3: 45
4: 229
Right 1184178130 22:42801420-42801442 TGTGCCCAGTGCAGGTGGGCAGG 0: 1
1: 0
2: 5
3: 55
4: 474
1184178124_1184178136 26 Left 1184178124 22:42801399-42801421 CCACCCACAACTGATGTTTGCTG 0: 1
1: 0
2: 3
3: 45
4: 229
Right 1184178136 22:42801448-42801470 CTGTGCATCACAGTCACTTGCGG 0: 1
1: 0
2: 8
3: 67
4: 334
1184178124_1184178127 -10 Left 1184178124 22:42801399-42801421 CCACCCACAACTGATGTTTGCTG 0: 1
1: 0
2: 3
3: 45
4: 229
Right 1184178127 22:42801412-42801434 ATGTTTGCTGTGCCCAGTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 217
1184178124_1184178132 0 Left 1184178124 22:42801399-42801421 CCACCCACAACTGATGTTTGCTG 0: 1
1: 0
2: 3
3: 45
4: 229
Right 1184178132 22:42801422-42801444 TGCCCAGTGCAGGTGGGCAGGGG 0: 1
1: 0
2: 4
3: 53
4: 554
1184178124_1184178129 -6 Left 1184178124 22:42801399-42801421 CCACCCACAACTGATGTTTGCTG 0: 1
1: 0
2: 3
3: 45
4: 229
Right 1184178129 22:42801416-42801438 TTGCTGTGCCCAGTGCAGGTGGG 0: 1
1: 0
2: 0
3: 26
4: 261
1184178124_1184178128 -7 Left 1184178124 22:42801399-42801421 CCACCCACAACTGATGTTTGCTG 0: 1
1: 0
2: 3
3: 45
4: 229
Right 1184178128 22:42801415-42801437 TTTGCTGTGCCCAGTGCAGGTGG 0: 1
1: 0
2: 1
3: 17
4: 255
1184178124_1184178131 -1 Left 1184178124 22:42801399-42801421 CCACCCACAACTGATGTTTGCTG 0: 1
1: 0
2: 3
3: 45
4: 229
Right 1184178131 22:42801421-42801443 GTGCCCAGTGCAGGTGGGCAGGG 0: 1
1: 0
2: 1
3: 49
4: 406
1184178124_1184178133 1 Left 1184178124 22:42801399-42801421 CCACCCACAACTGATGTTTGCTG 0: 1
1: 0
2: 3
3: 45
4: 229
Right 1184178133 22:42801423-42801445 GCCCAGTGCAGGTGGGCAGGGGG 0: 1
1: 0
2: 4
3: 75
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184178124 Original CRISPR CAGCAAACATCAGTTGTGGG TGG (reversed) Intronic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
904703498 1:32373361-32373383 CAGAAAAAATCAGTAGTGGTTGG - Intronic
905117540 1:35655201-35655223 ATCCAAACATCAGCTGTGGGTGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908916720 1:69136172-69136194 CATCAAACATCATTTGGGTGGGG + Intergenic
910821532 1:91355075-91355097 CAACAAACATAAATTGTGGGGGG + Intronic
911563636 1:99436113-99436135 CTGCAAAAATGAGTTGTGGCAGG + Intergenic
912747895 1:112260650-112260672 CAGCACTCATTAGTTGTGTGTGG - Intergenic
916518294 1:165540729-165540751 CATCAAACTTCAGTTGTGAAGGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921955300 1:220977192-220977214 CATCAAATATCACTTCTGGGTGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924942322 1:248820732-248820754 CAACAAACATTGATTGTGGGGGG + Intronic
1063227906 10:4033692-4033714 CAGAAACCATCTGGTGTGGGTGG - Intergenic
1064037907 10:11929930-11929952 CAGCAAACACCAATCGTGAGAGG - Exonic
1065551003 10:26868499-26868521 AAGCTAGCATCAGTTGAGGGTGG + Intergenic
1066486913 10:35854778-35854800 CACAAAAAATCAGTAGTGGGAGG + Intergenic
1067708889 10:48633138-48633160 CAGCAAACATGAGTTGTGCCAGG - Intronic
1068189170 10:53627862-53627884 CAGTAAACATCAGTTCTATGGGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069034026 10:63629823-63629845 CAGCAAACCCCAGTTGGGGGAGG - Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069735433 10:70650868-70650890 CAGCAAACAGTAGTAATGGGTGG - Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1075617088 10:123898014-123898036 CAGCAGACTACAGGTGTGGGAGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1079360869 11:19769499-19769521 CCACAAACATGAGTTGAGGGAGG - Intronic
1080122926 11:28698088-28698110 CAGCAAATAGCAGTTGAGGCTGG - Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1082711223 11:56555952-56555974 AAGCAAACAAAAGTTCTGGGTGG + Intergenic
1083450147 11:62738630-62738652 AAACATACATCAGTTGTGGGTGG + Exonic
1084762615 11:71283516-71283538 CAACACACATCAGTTGTGCTGGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1087915289 11:103803028-103803050 CAGCCAGCATCACTTCTGGGAGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088606580 11:111539546-111539568 CAGCTAACAGCGGTTGTGGCAGG - Intergenic
1092534761 12:9377554-9377576 CAGTAAACATCAGATGTCTGTGG - Intergenic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096357237 12:50951551-50951573 GAGAAAACATGAGTTGGGGGAGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098092187 12:66915522-66915544 CAGCAGGCATCAGACGTGGGTGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100359492 12:93862968-93862990 CAGTAAACATGAATTGTTGGAGG - Intronic
1102074214 12:110047273-110047295 CTTGAAACATAAGTTGTGGGAGG - Intronic
1102224179 12:111216357-111216379 CAGGAAACATTAGTTCTGGATGG - Intronic
1102839750 12:116106033-116106055 CTGCCAACATGAGTTGTGGAGGG + Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105252049 13:18708009-18708031 AAGTAAACATCTTTTGTGGGAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107553016 13:41494503-41494525 CAGCCAAGATCAGGTCTGGGAGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110519614 13:76459714-76459736 CACCAAAGAACAATTGTGGGAGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1118001503 14:61527567-61527589 AAGAAAAGATCAGTTGGGGGAGG - Intronic
1118849749 14:69574303-69574325 CAGCAAACACCCGGTGGGGGTGG - Intronic
1118914331 14:70089264-70089286 AGGCAAACACCAGCTGTGGGAGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119484018 14:74976835-74976857 CAGCAAAGAGCAGCTGTGAGTGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120487238 14:85129482-85129504 CAGGAAACTTCAGTTCAGGGAGG + Intergenic
1123736015 15:23183737-23183759 CAGCAAACAGCAGTAGTAAGAGG - Intergenic
1123982744 15:25619029-25619051 CAGCAAACTGCAGCTGTGGGAGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1127245556 15:57169379-57169401 CAGTAAATGTCAGTTGAGGGGGG + Intronic
1128320700 15:66691861-66691883 GGGAAAACATCAGTTGTAGGAGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130770262 15:86917028-86917050 CAGCAAACTTCAGCTGGGGTGGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131608166 15:93931810-93931832 TAGAAAACTTTAGTTGTGGGAGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132215167 15:100057105-100057127 CTGCTAAGATCAGTTCTGGGCGG + Intronic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1134388010 16:13792474-13792496 CAGCAAAAATCATTAGTGTGAGG - Intergenic
1134842755 16:17414794-17414816 GAGCAAACGGCAGTTGAGGGTGG - Intronic
1135017211 16:18933849-18933871 CAGCAAACATCAGGGATGGAAGG + Intergenic
1136108950 16:28052711-28052733 CAGCAATCTGCAGATGTGGGAGG - Intronic
1136278843 16:29195571-29195593 CAGAAAACATCAGTTTTGTAAGG + Intergenic
1140819380 16:78648789-78648811 CAGCCACCATCAGTTGTGTTTGG - Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1142083241 16:88161690-88161712 CAGAAAACATCAGTTTTGTAAGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149327281 17:55544978-55545000 CATCAAACATCTGTTGAGGTAGG - Intergenic
1150121857 17:62610300-62610322 CAGTAAATATTTGTTGTGGGAGG - Intronic
1150582010 17:66482646-66482668 CAGCAAGCATCACTTGTATGTGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154171391 18:12054737-12054759 CAGCAAACATCAGTACTTAGTGG + Intergenic
1155370828 18:25098463-25098485 CTGCAAACACCAGTTTTGGAAGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160782115 19:882356-882378 CAGTAAACATTAGCTGTGTGTGG + Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG + Intronic
1166715987 19:44968175-44968197 CATCAAACATCAGTTCGGGTGGG + Intronic
1167042773 19:47032427-47032449 CAGCATCCATCTATTGTGGGGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168569095 19:57449888-57449910 CAGCAAACTGGAGTTGTAGGAGG - Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
928405084 2:31008656-31008678 CAGCCAGCATGAGTGGTGGGAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930782526 2:55236975-55236997 CAGCAAACTTCATTTTTGAGGGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931268720 2:60683251-60683273 CAGGGAAGATCAGTTGTGGTCGG + Intergenic
932805344 2:74778312-74778334 CAGCAAACACTTGGTGTGGGAGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933676415 2:85061599-85061621 CAGCCAACATCTGTTATGGCTGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935934365 2:108165920-108165942 CAGCATGCACCAGCTGTGGGTGG - Intergenic
937715876 2:125031799-125031821 AAGCAAATATCAGTTGTAGAAGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939682811 2:145159879-145159901 CAGGAAACACTAGTTGAGGGTGG + Intergenic
942265306 2:174218750-174218772 CAGCAAACCCCAGGGGTGGGAGG + Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
943206794 2:184908964-184908986 CAGCTAACTTCAGTTTTTGGAGG + Intronic
944057148 2:195534555-195534577 CAACAACCTTCAGCTGTGGGCGG - Intergenic
944496786 2:200315342-200315364 CAGCCATCATCAGAAGTGGGAGG + Intronic
947264837 2:228267022-228267044 AAGGAAACATCAGGTATGGGAGG + Intergenic
947693027 2:232157386-232157408 CAGGAGGCATCAGTTGTGAGGGG - Intronic
1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173168344 20:40701824-40701846 CATCCAACAGCAGTTGGGGGTGG + Intergenic
1175571007 20:60022062-60022084 CTGCAGACATCAGTTGGGGAAGG - Intronic
1175613512 20:60372504-60372526 ATGCAAACATCAGTTCTAGGAGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177535883 21:22426695-22426717 AATCCAACATCAGTTGTAGGAGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179823551 21:43951398-43951420 CAGCAGACAGCAGTTGGCGGAGG - Intronic
1182753476 22:32659924-32659946 CAGCAAACATGATTTGCTGGAGG - Intronic
1182943843 22:34303664-34303686 CAGCCAAAATCAGTTGTTTGAGG - Intergenic
1184072506 22:42154769-42154791 CAGCAAACATGGGTGGTGGGTGG - Intergenic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1184505166 22:44896143-44896165 CAACAAACATCTGCTGTGGCAGG + Intronic
1184929191 22:47668226-47668248 CACCAAACATGAGTTTTGGTGGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
954685512 3:52368050-52368072 GAGGAAACATCAGTGGTGAGGGG + Intronic
956612327 3:71136669-71136691 CAGCAAAAAACAGTTGTTGATGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957061401 3:75484107-75484129 CAGGAAACAACAGGTGTTGGAGG - Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959137177 3:102437824-102437846 CACCAAGGAGCAGTTGTGGGAGG + Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959432113 3:106267686-106267708 AACAAAACATCAGTTGTGGCAGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962878381 3:139553441-139553463 CAGTAAACAACATTTTTGGGAGG + Intergenic
968552824 4:1232791-1232813 CAGCGAGCATCTGTGGTGGGGGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969655310 4:8494044-8494066 CAGAAAACACCAGGTGTGTGAGG + Intergenic
972385446 4:38561417-38561439 CATCCAACATGAGATGTGGGTGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976329975 4:83819672-83819694 AAGCAAACAAAAGCTGTGGGAGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983941344 4:173537431-173537453 GAGAAAACTTCATTTGTGGGAGG - Intergenic
984750559 4:183268993-183269015 CAGCTGACATCAGTTGAGGAAGG - Exonic
985023566 4:185716826-185716848 GAGGAAACATCAGTGGAGGGAGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
992142769 5:73816101-73816123 CAACAAACATCTGGGGTGGGGGG + Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992311162 5:75500134-75500156 CAGCAAACACCAGATGTAAGGGG + Intronic
995908028 5:117149820-117149842 CAGAAATCATCAGGGGTGGGAGG - Intergenic
996551005 5:124730132-124730154 CAGCACACACCAGTAGTAGGAGG - Intronic
997214287 5:132097435-132097457 CAGCAAATCTCAGTGGTGTGGGG + Intergenic
1001027340 5:168235387-168235409 AAGCAAACATTACTTTTGGGTGG + Intronic
1003988390 6:11460987-11461009 AAGCAAACATCTGTTCTTGGTGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1008277371 6:49557371-49557393 CAGCCAACATCATTTGTGCTTGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1011902676 6:92319620-92319642 CAGCAAAATTCAGTTGTGCCTGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014478849 6:121910191-121910213 CAACAAAAAACAGTTGTGAGAGG - Intergenic
1014645480 6:123967593-123967615 CACCAACCTTCAGTTGGGGGTGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016982997 6:149869971-149869993 TGGCAAACATCAGTTCTCGGGGG + Intergenic
1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG + Exonic
1018177215 6:161187466-161187488 CAGCAAAAATCAGTTAAGGATGG + Intronic
1018731515 6:166655331-166655353 TCACCAACATCAGTTGTGGGTGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023133009 7:37022092-37022114 CTGCAAAGATCAGTTCTGCGTGG + Intronic
1024030245 7:45454592-45454614 CATCAAACAATAGTTGTGTGTGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025041388 7:55648986-55649008 CAGTAAACATCAGTAGTGAAGGG - Intergenic
1027888061 7:83935093-83935115 CAGCAGTCATCAGATGTGGGTGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028103522 7:86850149-86850171 AAGCAAACACCATTTGTGTGGGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032341606 7:131079167-131079189 CTGCAGATAACAGTTGTGGGAGG - Intergenic
1032831461 7:135631531-135631553 AAGCAAACATCATCTGAGGGTGG - Intronic
1033369599 7:140696529-140696551 CAGCAACCATAAGTTATGCGTGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1039424386 8:37473874-37473896 GAGCCAACATCAGGGGTGGGGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039712766 8:40073558-40073580 CAGAAAACATCAGCTCTAGGTGG + Intergenic
1043721840 8:83554505-83554527 AATCAAACATGAGATGTGGGTGG - Intergenic
1045498909 8:102730125-102730147 CAGCAGAGATCAGTCGGGGGAGG - Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048567290 8:135614971-135614993 GAGGAAACATCAGTGGTAGGGGG + Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1059367781 9:113800177-113800199 CAGAAAACAGCAGCTGTGGAGGG + Intergenic
1060367567 9:123034011-123034033 CAGTACAGATCAGTTGTGTGGGG + Intronic
1187707260 X:22020993-22021015 AAGAAAACATCAGCTTTGGGAGG - Intergenic
1188073401 X:25745708-25745730 CAGCAAATGACAGTTGTGGCTGG - Intergenic
1189723403 X:43943951-43943973 CAGTAAAGAACAGTTTTGGGTGG + Intergenic
1189736038 X:44070945-44070967 CAGCAAACATTATTTGGGTGAGG - Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1190366610 X:49700596-49700618 CAGCCACCATCATTTGTGGTTGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193567555 X:83096964-83096986 CAGGAAACAACAGGTGTTGGAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196039349 X:111185049-111185071 CAGGAAACAACAGATGTTGGAGG - Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196821067 X:119701186-119701208 GAGCAAACAACAGTTGTTTGGGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1200254968 X:154575820-154575842 AAGTTAACATCAGATGTGGGTGG - Intergenic
1200262801 X:154628588-154628610 AAGTTAACATCAGATGTGGGTGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201641575 Y:16183805-16183827 CATCCAACATCAGTTGGGGTTGG + Intergenic
1201661240 Y:16401517-16401539 CATCCAACATCAGTTGGGGTTGG - Intergenic