ID: 1184179237

View in Genome Browser
Species Human (GRCh38)
Location 22:42808635-42808657
Sequence GCCCTCTGGCCTGAAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184179237_1184179240 7 Left 1184179237 22:42808635-42808657 CCAGCACTTTCAGGCCAGAGGGC 0: 1
1: 0
2: 2
3: 14
4: 181
Right 1184179240 22:42808665-42808687 AGCCTGAGCCCAGCTCACTCAGG 0: 1
1: 0
2: 2
3: 33
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184179237 Original CRISPR GCCCTCTGGCCTGAAAGTGC TGG (reversed) Intronic
900034148 1:393016-393038 GCCCTCAGTCCTGAGAGTGAGGG - Intergenic
900054984 1:622906-622928 GCCCTCAGTCCTGAGAGTGAGGG - Intergenic
900296884 1:1956343-1956365 GCCCTCGGGCCTGGAGCTGCTGG + Intronic
901327530 1:8377202-8377224 GGCCTCTGGCCTGGAAGCCCTGG + Intronic
901930515 1:12594044-12594066 GACCTCTTGCTGGAAAGTGCTGG + Intronic
903273720 1:22207980-22208002 TCCCCATGGCCTGAAAGTGAGGG - Intergenic
904000537 1:27336097-27336119 CCTCTCTGGCCTCAAACTGCAGG - Exonic
905174165 1:36125641-36125663 GCCCTAAAGCCTGAATGTGCGGG - Intergenic
905664715 1:39756058-39756080 CCCTTCTGGCCTGGAAGAGCAGG - Intronic
906004329 1:42456091-42456113 GCCCTCTGCCCTTGAAATGCTGG - Exonic
912706915 1:111921515-111921537 TACCTCAGGCCTGAAAGGGCAGG + Intronic
912942947 1:114061142-114061164 CCTCTCTGGCCTGAAGGGGCAGG - Intergenic
914063938 1:144229972-144229994 CACCTCAGCCCTGAAAGTGCTGG + Intergenic
914115212 1:144736382-144736404 CACCTCAGCCCTGAAAGTGCTGG - Intergenic
914722792 1:150303039-150303061 GCCCTTTTGCCTGACAGTACAGG + Intronic
915402909 1:155636896-155636918 GCCCTCTGGGCTGGGAGTGTTGG - Intergenic
915438068 1:155924455-155924477 CGCCTCGGCCCTGAAAGTGCTGG + Intronic
915911843 1:159920295-159920317 CCCCACTGGCTTGGAAGTGCAGG - Intronic
918038781 1:180899496-180899518 GCCATCTGGCCTGCAGATGCTGG + Intergenic
921030369 1:211330805-211330827 CTCCTCTGTCCTGCAAGTGCAGG + Intronic
921458131 1:215396093-215396115 GCTCTATGGCCTCAAACTGCTGG - Intergenic
922256503 1:223897185-223897207 GCCCTCAGCCCTGAGAGTGAGGG - Intergenic
924337712 1:243000044-243000066 GCCCTCAGCCCTGAGAGTGAGGG - Intergenic
924342409 1:243050046-243050068 GCCATCTGCCCTGAAAGCCCAGG + Intergenic
1064055973 10:12097822-12097844 GCCCCCTGCCCTGAACCTGCAGG + Exonic
1064192539 10:13220187-13220209 GCCCTCTTGCCAGAAAGCACTGG + Intergenic
1069632608 10:69906056-69906078 ACTCTCTGGCCTGTAAGAGCTGG - Intronic
1071423537 10:85525944-85525966 GCCCCCTGGCCTGGAAGGTCTGG - Intergenic
1072586523 10:96787719-96787741 GTCATTTGGCCTCAAAGTGCTGG + Intergenic
1072957655 10:99901602-99901624 GAGCTGTGGCCTGAACGTGCGGG + Intronic
1073343545 10:102764490-102764512 TCTCTGTGGCCTGGAAGTGCAGG + Intronic
1074185319 10:111096137-111096159 CCTCTCTAGCCTGAAACTGCTGG + Intergenic
1075070000 10:119314263-119314285 GCCTCCTGGCCTGACAGTTCTGG + Intronic
1075726558 10:124613552-124613574 GCCCTCTGCCCTGCATGGGCAGG + Exonic
1076652446 10:131999220-131999242 GCCCTCATGGCTGTAAGTGCTGG + Intergenic
1076777261 10:132704694-132704716 GCCGTCTCCCCGGAAAGTGCAGG + Intronic
1077101847 11:825956-825978 GCCCCATGGCCTGAGGGTGCTGG + Intergenic
1085183765 11:74558178-74558200 GCAGGCTGGACTGAAAGTGCTGG - Intronic
1085640409 11:78189375-78189397 GCCCTCTTACCTGAAAGGGGAGG - Intronic
1088298682 11:108330371-108330393 TCCCTCTGGCTTGAAAATTCTGG + Exonic
1089068000 11:115676639-115676661 GGCCTTTTGCCTGTAAGTGCTGG + Intergenic
1089398242 11:118149684-118149706 GCTCTCTGGCCTGTAAGAGGAGG - Intronic
1090084562 11:123640066-123640088 GCTCTCTGGGCTGAAAGTTATGG - Intronic
1091753707 12:3038413-3038435 GCCCTCTGGCTTCACAGTGGAGG + Intronic
1092077014 12:5682389-5682411 GCCCTCCAGCCTGAGAGAGCTGG - Intronic
1096534448 12:52262357-52262379 GCCCCCAGACCTGAAAGAGCAGG - Intronic
1099174244 12:79402242-79402264 CCTCTCTTGCCTGGAAGTGCAGG + Intronic
1102490878 12:113288877-113288899 GCCCTCTGCCCGGGAAATGCAGG - Intronic
1102769867 12:115466247-115466269 GCCCTCTGTACTGAAATTGCTGG + Intergenic
1102947903 12:117006073-117006095 GCTCTCTGGACAGACAGTGCTGG + Intronic
1103929335 12:124440947-124440969 GCCCTGTGGCTGGACAGTGCTGG + Intronic
1112032550 13:95470987-95471009 CCCCTCTAGCCTGGAAGAGCAGG - Intronic
1113530406 13:111020421-111020443 GGGCTCTGCCCTGAAGGTGCTGG - Intergenic
1113576361 13:111397906-111397928 GCCCTCTGGCTTGAAGGGGCAGG - Intergenic
1119414328 14:74459616-74459638 GCCCTGTGTCCTGAAGATGCAGG - Intergenic
1119657304 14:76426204-76426226 GCCCCCTGGCCTGAAGATGGGGG + Intronic
1119714424 14:76848827-76848849 GCTCGCTGGCCTGAGAGAGCAGG + Intronic
1121558166 14:94854285-94854307 GGCCTCTGGCCTCAAAGAGCAGG - Intergenic
1122207616 14:100155953-100155975 GCTCCCTGACCTGAAAGGGCAGG - Intronic
1122855603 14:104558678-104558700 GCCATCTGGCCTGGAGCTGCTGG - Intronic
1202904224 14_GL000194v1_random:59341-59363 GCCCTCTGCCCTGAGGGGGCAGG - Intergenic
1123474974 15:20582820-20582842 GCCCTCTGCCCTGTGTGTGCAGG - Intergenic
1123643037 15:22417537-22417559 GCCCTCTGCCCTGTGTGTGCAGG + Intergenic
1130997014 15:88909552-88909574 GCCCTCTTTCCTGAGACTGCCGG - Intronic
1131387876 15:92022439-92022461 GCCCACTTGCCTTAAAGTGTAGG + Intronic
1131616261 15:94020014-94020036 GCACTATGGCCTCAAACTGCTGG + Intergenic
1134207309 16:12248662-12248684 TCCCTCTGCCCCCAAAGTGCTGG + Intronic
1135341417 16:21651367-21651389 TCCCTATAGCCTGAAAGTCCTGG + Intronic
1136066344 16:27761462-27761484 GCTCACTGGCCTGGAAGTGGTGG + Exonic
1138348217 16:56332736-56332758 GCCCTCTGGCCTCTCTGTGCTGG - Intronic
1139914646 16:70420531-70420553 GCTCTCTGGCCTCCTAGTGCTGG - Intronic
1141032786 16:80604158-80604180 GCTCTCTGGCCAGGAAGGGCAGG + Exonic
1141477522 16:84283790-84283812 GTCCTTTGTCCTGAAAGGGCAGG + Intergenic
1141657671 16:85424708-85424730 GCCCTCGCGCCTGTCAGTGCTGG - Intergenic
1143129806 17:4670998-4671020 GCCCCTTGGTCTGAAAGGGCAGG - Intergenic
1144457825 17:15433322-15433344 GCCCTTTGGTCTAAAAGTGTGGG + Intergenic
1148148887 17:45384457-45384479 CCCCTGTGGCCTGTAAATGCTGG - Intergenic
1148787460 17:50152262-50152284 CCCCCCTGGCCTGGAAGGGCTGG + Intergenic
1148864147 17:50619848-50619870 GCCCTCTCCCCTGACCGTGCTGG + Intronic
1150945731 17:69743519-69743541 GCCCTCTGGCCAGAACTTGGGGG - Intergenic
1151069855 17:71196501-71196523 GCACTGTGGCCTGACACTGCTGG - Intergenic
1151307354 17:73271833-73271855 GCCCTCTGGCTGCAAAGTCCTGG + Intergenic
1151455883 17:74225618-74225640 TCCCTCTGGCCTGCAGGTGGTGG - Intronic
1151664073 17:75535520-75535542 GCCCTCTGGCCTGGAGATGTGGG - Intronic
1152558369 17:81065844-81065866 GCCCTTTGGCCTGGCTGTGCAGG + Intronic
1152690055 17:81713856-81713878 GCCCTCTGGCCTGGGAGGGCGGG + Intronic
1153069550 18:1089554-1089576 GCCCCCTGGCCAGAACTTGCGGG - Intergenic
1155179692 18:23333693-23333715 GCCTTCTGCCCTGAAAGGGAGGG - Intronic
1157269890 18:46265258-46265280 GGCCTCTGCCCTGACAGTGGGGG - Exonic
1157383998 18:47247300-47247322 GCCCACTGGCCGGAAGGCGCTGG + Intronic
1157897824 18:51485326-51485348 GCTCTCAGGCCTGAATGTCCTGG + Intergenic
1158535523 18:58305004-58305026 GCCCTCTGGCCTGATAGGGCTGG - Intronic
1159939085 18:74392420-74392442 GCCCTCTGGCCTGAGTCTCCAGG + Intergenic
1160510855 18:79452553-79452575 CCCCTCTGGGATGAGAGTGCTGG - Intronic
1164600813 19:29562162-29562184 ATCATCTGGCCTGAAAGTCCAGG - Intronic
1167003847 19:46762593-46762615 GCCCTCTGGCCCAGAAGTCCAGG + Intronic
1168277350 19:55285117-55285139 TCCCTCAGACCTGAAAGTCCAGG - Intronic
926037760 2:9648515-9648537 CCCCTCTGGCCAGGCAGTGCAGG + Intergenic
929235268 2:39598357-39598379 GCACTGTGGCATGAAGGTGCAGG + Intergenic
929620062 2:43345661-43345683 CCCCACTGTCCTGAAAGAGCTGG + Intronic
931268622 2:60682625-60682647 GACCTCTGGGCTGAATGTGGAGG + Intergenic
934649786 2:96084304-96084326 GCCATCTCTCCTGAAAGTGCAGG + Intergenic
935846606 2:107172612-107172634 GCCCTCTTGACTGACAGGGCAGG + Intergenic
937585143 2:123537725-123537747 GCCCTCTGGGCTCACAGAGCTGG + Intergenic
938580014 2:132637370-132637392 GGCCTCTGGCCTCAACGTGGTGG + Intronic
939036188 2:137134236-137134258 GCCCTCTGCTCTGAAACAGCGGG - Intronic
942330675 2:174820719-174820741 CCCTTCAGGACTGAAAGTGCTGG - Intronic
942739264 2:179155448-179155470 GCACTCTCTCCTGAAAATGCAGG + Intronic
944594105 2:201245810-201245832 GCCCTTTGGCCAGAGAGAGCAGG + Intronic
945041383 2:205746181-205746203 GCCCTCTGGCCTGAAGAGCCAGG - Intronic
947713844 2:232330246-232330268 GTCCTGTGGCCAGAAAGGGCTGG + Intronic
947962804 2:234253729-234253751 GTTCTGTGGCCTGAAAGTGGTGG + Intergenic
948152203 2:235753148-235753170 GTCCTCTGCCTTGAACGTGCTGG - Intronic
948722747 2:239911824-239911846 GGAATCTGGCCTGAAACTGCTGG - Intronic
1170102881 20:12721553-12721575 GGCCTCTGGTCTGAAGGTGGTGG - Intergenic
1170440571 20:16375160-16375182 GCCCTCTGGCCTGATGGGGCTGG - Intronic
1172091054 20:32433242-32433264 CCACTCTGGCCTGAAACTGATGG + Intronic
1173866178 20:46313908-46313930 GCCCTGAGGCCTGACACTGCAGG + Intergenic
1175424193 20:58853875-58853897 GCCCTCAGGCCTGCAAAGGCTGG + Exonic
1176623595 21:9074108-9074130 GCCCTCTGCCCTGAGGGGGCAGG - Intergenic
1181030922 22:20148604-20148626 GGCCTCTGGCCTAGAAGGGCAGG + Exonic
1181236330 22:21449793-21449815 GCCCTCTGGCCGGACCATGCTGG + Exonic
1183664149 22:39237721-39237743 GCTCTCTGGCCTGCCAGTTCTGG - Intronic
1184179237 22:42808635-42808657 GCCCTCTGGCCTGAAAGTGCTGG - Intronic
1184658800 22:45955844-45955866 GGCCTCTGGCCTGAGACTGCAGG - Intronic
949941001 3:9154357-9154379 GCCCTCTCTCCTGTAAGAGCTGG - Intronic
952118331 3:30211568-30211590 GCCATCTTGCCTCAAACTGCTGG - Intergenic
953221058 3:40971963-40971985 CCCCTTTGGCCTGAGAGAGCTGG - Intergenic
955670257 3:61394479-61394501 GCCCTCTGGCTGCAAAGTCCTGG - Intergenic
955725059 3:61924254-61924276 ACCCTGTGACCTGCAAGTGCAGG - Intronic
961744756 3:129057416-129057438 GCCCTGAGGCAGGAAAGTGCTGG + Intergenic
966745987 3:183277506-183277528 GCCCTGAGACCAGAAAGTGCTGG + Intronic
968427181 4:531872-531894 GCCACCTGGCTTGAACGTGCTGG - Intronic
968965906 4:3769014-3769036 GGCCTCTGGCCTAAGAGTGATGG - Intergenic
969292427 4:6248582-6248604 GCCCTAGGTCCTGTAAGTGCGGG - Intergenic
969708902 4:8831596-8831618 GGCCTCTGGCCTGACAGATCTGG + Intergenic
972606938 4:40622384-40622406 GCCCTGTGGTATGAATGTGCTGG + Intronic
976221132 4:82757616-82757638 GGACTCTGGAGTGAAAGTGCTGG + Intronic
979239429 4:118435272-118435294 GCCCTCAGTCCTGAGAGTGAGGG + Intergenic
992133695 5:73721137-73721159 TCCCTTTGGCCTGGAAGAGCAGG + Intronic
994372556 5:98983766-98983788 ATCCTCTGGCCTTAAAGTGTTGG - Intergenic
995800213 5:115985712-115985734 GCACTCTGTCCTGAAATAGCTGG + Intronic
999268081 5:150279933-150279955 CCTCTCTGGCCTGAAACAGCAGG + Intronic
1000343620 5:160296281-160296303 TCCCTCTGCCCTGTAAGTGAAGG - Intronic
1001045013 5:168364875-168364897 GCCCTCTAGACTGTAAGGGCAGG + Intronic
1001896172 5:175383397-175383419 GCCCTTTGGCTAGAAAGAGCAGG - Intergenic
1001943350 5:175756577-175756599 GTCCTTTGGCCAGAAAGAGCAGG - Intergenic
1002739672 5:181425852-181425874 GCCCTCAGTCCTGAGAGTGAGGG + Intergenic
1006588910 6:35140588-35140610 GCCCTCGGGCCTGTAAGTAAAGG + Intronic
1010870507 6:81031452-81031474 GCTCTCTGCCTTGAAAGTCCAGG - Intergenic
1013313969 6:108923837-108923859 CACCTCTGGCAAGAAAGTGCGGG - Intronic
1013447874 6:110249458-110249480 GCCTTCTGACCTGAGAGTGCAGG + Intronic
1016384252 6:143515465-143515487 GCCCCCTGGCCTGAAAAAGGCGG - Intergenic
1017588891 6:155957108-155957130 GCCCACTTGCCTGAAAGAGCAGG - Intergenic
1018463844 6:164024314-164024336 GCCATCTGGGATGAATGTGCAGG + Intergenic
1018785166 6:167102613-167102635 GCCTGCTGGCCTGGAAGTGCTGG - Intergenic
1019244787 6:170701438-170701460 GCCCTCAGTCCTGAGAGTGAGGG + Intergenic
1019646278 7:2130795-2130817 GCCATCTGGTCTGTAGGTGCAGG - Intronic
1022768846 7:33447215-33447237 GCCATCTGGCCTAGAAGTGAAGG - Intronic
1031042076 7:116849289-116849311 CCACTTTGGCCTCAAAGTGCTGG - Intronic
1031279192 7:119774371-119774393 GCCTTGTGGCCTGTAAGTACTGG - Intergenic
1031949019 7:127872346-127872368 GCTTTCTGGCCTGAGAGGGCTGG + Intronic
1031977341 7:128102476-128102498 AGCCTCTGGCCTGAAAGGGCTGG - Intergenic
1032245184 7:130205376-130205398 GTCCTCTGGCCGGAAAACGCAGG + Exonic
1032831188 7:135628087-135628109 GCCCTGCTGCCTGCAAGTGCTGG - Exonic
1035443650 7:158924378-158924400 GCGCTGTGGACTGAAGGTGCAGG + Intronic
1035476906 7:159150068-159150090 ACCCTCTGGCCTGGAATCGCTGG - Intergenic
1035503338 8:106749-106771 GCCCTCAGTCCTGAGAGTGAGGG - Intergenic
1041443581 8:57925939-57925961 TGCCTCTGCCCTCAAAGTGCTGG + Intergenic
1042325813 8:67526647-67526669 ACCACCTGGCCTGATAGTGCTGG - Intronic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1048220549 8:132537214-132537236 GCCCTCTTGCCTGACAGTTGTGG - Intergenic
1049259232 8:141629856-141629878 GCCCTCTGCCCTGACAGAGCTGG + Intergenic
1049935377 9:496765-496787 GCCTGCTGTGCTGAAAGTGCTGG - Intronic
1050079999 9:1905738-1905760 GCCCTCTGGGCCGGAAGTGGTGG - Intergenic
1056728587 9:89143863-89143885 TCCCTCTCGCCTGAAAATGAGGG - Intronic
1056872995 9:90302499-90302521 GCTCTCTGGCCAGAAAATGCTGG - Intergenic
1058625375 9:106928388-106928410 GCACCCTGGCATGAAAGTGAAGG + Exonic
1059136096 9:111807904-111807926 GTCCTCCTGCCTAAAAGTGCTGG - Intergenic
1059657579 9:116370036-116370058 CTCCTCTGGCCTGGAAATGCTGG - Intronic
1061454169 9:130685041-130685063 GCCCTTTGGACTGAATCTGCGGG - Intergenic
1062564477 9:137158007-137158029 GCCCTCTTGCCAGCAAGTGAAGG - Intronic
1062564643 9:137158758-137158780 CCCCTCTGGCCTGAAGGAGGAGG + Intronic
1062612906 9:137382998-137383020 GGCCTCAGGCCTGGCAGTGCTGG + Intronic
1203746779 Un_GL000218v1:44536-44558 GCCCTCTGCCCTGAGGGGGCAGG - Intergenic
1203563327 Un_KI270744v1:74944-74966 GCCCTCTGCCCTGAGGGGGCAGG + Intergenic
1203604978 Un_KI270748v1:50659-50681 GCCCTCAGTCCTGAGAGTGAGGG + Intergenic
1189615378 X:42778132-42778154 GCCCTCCAGTCTGAAACTGCAGG + Intergenic
1190168535 X:48092998-48093020 GCCCTGTGGCCTGAACCTTCTGG - Intergenic
1193944923 X:87723255-87723277 GCCCTGTGACCTGCAAGTACTGG - Intergenic
1195673537 X:107488684-107488706 ACCCACTGGACTGAAAGTGCCGG - Intergenic
1196734352 X:118971786-118971808 GCCCTCTTGGCTGCCAGTGCAGG - Intergenic
1196959972 X:120990786-120990808 GCCCTTTGGCCTGAAAGGGCTGG + Intergenic
1199876036 X:151929248-151929270 GCCCTGTGATCTGAATGTGCAGG + Intergenic
1200830797 Y:7687523-7687545 GCCCAATGGCCTGAATGTTCTGG + Intergenic
1201160107 Y:11159550-11159572 GCCCTCTGCCCTGAGGGGGCAGG - Intergenic
1202387164 Y:24337055-24337077 GCCCTCAGTCCTGAGAGTGAGGG + Intergenic
1202483622 Y:25333073-25333095 GCCCTCAGTCCTGAGAGTGAGGG - Intergenic