ID: 1184179294

View in Genome Browser
Species Human (GRCh38)
Location 22:42809194-42809216
Sequence CTGCTCTCTCTACATTGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184179294 Original CRISPR CTGCTCTCTCTACATTGTAT AGG Intronic
900515757 1:3081527-3081549 CAGCTCTCTCTGCAGAGTATAGG + Intronic
902095301 1:13939052-13939074 CAGGTCTCTCTCCATTGTCTTGG + Intergenic
902301247 1:15504420-15504442 CTGCTCTGTCTGCTTTGTAGAGG - Intronic
904959277 1:34318637-34318659 CTGCTGTTTCTATATTGTAGAGG + Intergenic
906238216 1:44224808-44224830 CTGGTCTCTCTTTATTGTAGTGG - Intronic
911383275 1:97142104-97142126 CTATTCTCTCTGCATTCTATGGG - Intronic
911834379 1:102597163-102597185 CTACTCTTTCTTCATTGTCTTGG - Intergenic
915230316 1:154441101-154441123 CTGCTCTCTCTGAATTCTTTTGG + Intronic
915725309 1:158013166-158013188 CCTCTCTCTCTAAATTTTATGGG - Intronic
918617669 1:186565107-186565129 CATCTCTCTCTAGATTATATTGG - Intergenic
920791871 1:209100725-209100747 CTGCTCTCTGCACATTATAAAGG - Intergenic
921403273 1:214750234-214750256 CTGCTCTTTAAAAATTGTATAGG - Intergenic
923774656 1:236967623-236967645 GTGCTCTCTCTAGACCGTATTGG + Intergenic
1064087519 10:12356355-12356377 CTGCTCTGTCTACACATTATGGG + Intronic
1066291567 10:34019031-34019053 CTGCTCTCTCTGCACTGGTTGGG - Intergenic
1072135863 10:92545213-92545235 CTTCTATTTCAACATTGTATTGG + Intronic
1075590857 10:123690422-123690444 CTGCTTTCTCTGTACTGTATAGG + Exonic
1075613926 10:123877322-123877344 ATGCTTTATCTTCATTGTATTGG + Intronic
1076126315 10:127976931-127976953 CGGCTGTCTCTGCATTCTATCGG - Intronic
1076249582 10:128974907-128974929 CTGCTCTCTCTTCATTCCACTGG + Intergenic
1077403768 11:2372909-2372931 CTTCTCTTTCTAGATTGTTTTGG + Intergenic
1078753664 11:14188369-14188391 CTGCCACCTCTTCATTGTATAGG - Intronic
1079771676 11:24469114-24469136 CTACTCTCTCTATATAGGATTGG - Intergenic
1083171078 11:60924461-60924483 CTGCTCCCGCTCCATTGTCTGGG + Exonic
1091707545 12:2707863-2707885 CTGCTTTCTCTGCATTCCATAGG - Intergenic
1093391172 12:18624514-18624536 CTTCTCTCCCTATATTGTAAGGG + Intronic
1094329771 12:29278537-29278559 GTGGTCTCACTACATTGTACAGG + Intronic
1094761578 12:33539451-33539473 GTGGTCTCTCTACATTGTCCAGG + Intergenic
1095077832 12:37954006-37954028 CTTCTCTTTCTAGTTTGTATTGG + Intergenic
1099514402 12:83579069-83579091 TTGCACTAGCTACATTGTATGGG + Intergenic
1100194825 12:92233221-92233243 CTGATCTTTGTACATTCTATGGG - Intergenic
1104163657 12:126205354-126205376 CTGATCTCTCTCCTTTGTATTGG + Intergenic
1104350372 12:128040048-128040070 CTGCACTCTGTCCATTGTTTAGG + Intergenic
1105123220 13:16815843-16815865 CTTGTCTGTCTACATTTTATAGG - Intergenic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1112421251 13:99251205-99251227 CTGATCTTTCTACATTGATTTGG + Intronic
1120383431 14:83812151-83812173 TTGCTCTCTCTACTTGGTGTGGG + Intergenic
1121257701 14:92543285-92543307 TTGCTTTTTCTACATTTTATAGG - Intronic
1123400848 15:19984212-19984234 CTGTTCTCACTACAGTGCATGGG + Intergenic
1125182613 15:36895005-36895027 CTGCTTTCTTTACATTGGGTGGG - Intronic
1126537811 15:49785585-49785607 CTTCTCTTTCAACATTGTATTGG + Intergenic
1129581340 15:76814298-76814320 TTTCTCTCTCCACATTGTTTTGG - Intronic
1131610439 15:93955578-93955600 CCACTCTGTGTACATTGTATAGG + Intergenic
1133601659 16:7345627-7345649 CCTCTCTGTCTACATTGTAAGGG + Intronic
1135005768 16:18820716-18820738 AAGCTTTCTCTACAGTGTATTGG - Intronic
1137731574 16:50693980-50694002 CTGCTCTCTGTACCTCTTATGGG + Intronic
1138880542 16:61008905-61008927 CTACCCTCTCTACATAGTTTGGG + Intergenic
1141237869 16:82236310-82236332 CTTCTCTTTCAACATTGTGTTGG - Intergenic
1149309133 17:55377190-55377212 CTGCTTTCTCTTCATTCTTTGGG + Intergenic
1150641576 17:66953203-66953225 CTGCTCTCCCCACATTGTGTGGG + Intergenic
1150690681 17:67364676-67364698 TTGTTCTAGCTACATTGTATTGG + Intronic
1150962412 17:69928814-69928836 TTGCTCTCTCCACATTGGCTTGG - Intergenic
1152346275 17:79753982-79754004 GTGGTTTCTCTACATTGTCTAGG - Intergenic
1156288037 18:35718657-35718679 CTGCTCTGTCTTCATAGAATTGG - Intergenic
1166861861 19:45815838-45815860 CTGCTCTCCCTACCTTGGGTAGG + Exonic
925404811 2:3599188-3599210 CTGATCTCTGTGCAGTGTATGGG + Intronic
926170098 2:10547776-10547798 CTGCTCTCTATACATCCTGTTGG + Intergenic
926358617 2:12064390-12064412 CTGTTCTCCCTACATTGCACTGG + Intergenic
933267894 2:80201918-80201940 CTGCCCTCGCTACATTTTAATGG + Intronic
937704016 2:124896955-124896977 CTTCTCTCTTTACTTTGTAAAGG + Intronic
937853276 2:126655236-126655258 CAGCTGTCTGTACAATGTATGGG - Intergenic
938038772 2:128058615-128058637 AGGCTCTCTCTACATTGCCTAGG - Intergenic
938275514 2:130017700-130017722 GTGGTCTCACTACATTGTAGAGG - Intergenic
938439855 2:131319633-131319655 GTGGTCTCACTACATTGTAGAGG + Intronic
944546129 2:200800608-200800630 CTGCTCACTACATATTGTATAGG + Intergenic
1169499691 20:6147679-6147701 CTGCACTTTCCACATTGTATAGG - Intergenic
1170772455 20:19344975-19344997 CTGGTCTCACTACATTGTCTAGG - Intronic
1171026446 20:21634691-21634713 CTCCTGTCTCTACATTCTGTTGG - Intergenic
1171248288 20:23630616-23630638 TTGCTCTCTCTACATCTTTTAGG + Intronic
1171714454 20:28453914-28453936 CTTCTCTATCTAGATTTTATTGG - Intergenic
1175542735 20:59757992-59758014 CTTCTCTCTCTCCATTCTGTGGG - Intronic
1175936100 20:62514786-62514808 CTGCTCTCTCTCCATCGTGGGGG + Intergenic
1176258633 20:64167178-64167200 CTGCTCTCTCTGCACAGTACTGG - Intronic
1178363910 21:31972624-31972646 CTGTTCCCTCTGCATTGTTTTGG + Intronic
1182407525 22:30149582-30149604 TTGCTCTCTCTGCCTGGTATTGG + Intronic
1184179294 22:42809194-42809216 CTGCTCTCTCTACATTGTATAGG + Intronic
1184327682 22:43802635-43802657 CTTCTCTCTCTTCTTTGTAGGGG - Intronic
949426397 3:3921554-3921576 CTGATCTATCTACATTTTACAGG + Intronic
949756555 3:7417895-7417917 TTGCTCTCTCCAAATAGTATGGG - Intronic
949772662 3:7595851-7595873 CTGATCCCTTGACATTGTATAGG + Intronic
953204493 3:40812329-40812351 CTGCTTTCTTTTCTTTGTATAGG + Intergenic
956156273 3:66301575-66301597 CTGCTCTCTATAAATTATGTTGG - Intronic
960254765 3:115500190-115500212 CTGGTCTGGCTACATTGTTTGGG - Intergenic
960870240 3:122241012-122241034 CTGCTTTCACTATATTGCATAGG - Intronic
962942338 3:140137003-140137025 CTGCTGCCTCTAGATTATATTGG + Intronic
963318352 3:143785231-143785253 TTGCTCTCACTGCCTTGTATTGG - Intronic
964024435 3:152055205-152055227 TTCCTCTCTCTAAAATGTATTGG + Intergenic
970004472 4:11397288-11397310 CTGCTCTCTGTTCATGATATGGG + Exonic
971333652 4:25703075-25703097 GTGATCTCTCCACATGGTATGGG + Intergenic
975634360 4:76431864-76431886 TTGCTCTCTCAAAAATGTATAGG + Intergenic
975979640 4:80142894-80142916 CTACTCTTTCTACATTTTAAGGG + Intergenic
977658060 4:99546815-99546837 CTTTTCTCTCAACATTGTTTTGG - Exonic
979761698 4:124413926-124413948 CATCTCTTTCTGCATTGTATTGG - Intergenic
980300436 4:130983980-130984002 GTTCTCTGTCTACATTATATTGG - Intergenic
980901715 4:138911419-138911441 GGGCTCTCTCCACATTTTATCGG - Intergenic
982730121 4:158946818-158946840 CTGCTTTCTTTACCTTCTATTGG - Intronic
983189900 4:164744222-164744244 CTCTTCTCTCCACATTCTATTGG + Intergenic
983607052 4:169599171-169599193 TGGCTCTCTCTACATAGTAATGG - Exonic
986043350 5:4013855-4013877 CTGCTCTCCCTCCACTGAATGGG + Intergenic
990252869 5:53934554-53934576 CTGGTCTCCCTACATACTATAGG - Intronic
990371514 5:55123885-55123907 CTGCTGCCACTACATTGTACTGG - Intronic
990760080 5:59119340-59119362 ATGCTCTCTATATATTGTATAGG + Intronic
998028606 5:138843484-138843506 CTTCTCACTCTCCATTTTATAGG + Intronic
998896144 5:146802232-146802254 CTGCTCTCTCTAGAATGCATTGG + Intronic
999442082 5:151609761-151609783 CTGCTCTTTCAAGATTGTTTTGG + Intergenic
1003299962 6:4871134-4871156 TTGTCCTCTCTACATTGAATGGG + Intronic
1007545367 6:42689554-42689576 CTGATCTCTCTACAGAGTACGGG + Exonic
1008352472 6:50508233-50508255 CTGCTCTCTACACATTGAACAGG - Intergenic
1010965867 6:82207623-82207645 CTGCTATTTCAAGATTGTATTGG - Intronic
1014523022 6:122468313-122468335 CTGCTAAATCTACAATGTATAGG - Intronic
1015658559 6:135546962-135546984 CTGCTCTCACAACACTGTCTGGG - Intergenic
1016077875 6:139819048-139819070 CTCCTCTCCTTATATTGTATTGG - Intergenic
1017438375 6:154439440-154439462 CTCCTCTCCCTACATTGCAGTGG + Intronic
1017687144 6:156924818-156924840 CTGCTCTCTATACTTTTTGTAGG - Intronic
1018972173 6:168537215-168537237 CTGCTCTCTCTAAATAGGACCGG - Intronic
1018972178 6:168537293-168537315 CTGCTCTCTCTAAATAGGACCGG - Intronic
1023668727 7:42554051-42554073 CTCTTTTCTCTGCATTGTATTGG + Intergenic
1027806321 7:82829098-82829120 TAGCTTTCTCTACAATGTATAGG - Intronic
1031137978 7:117906671-117906693 TTGCTCTCTCTCCACTGCATCGG + Intergenic
1031445697 7:121850898-121850920 CTTCTCTCTCTACAATATCTAGG - Intergenic
1032112680 7:129090155-129090177 CTGCTCTATATAAAATGTATTGG - Intergenic
1032618318 7:133498907-133498929 CTGCTGTCTATACATGGAATTGG + Intronic
1033617453 7:143030151-143030173 ATGCTCTCTCTACTTTGCAGTGG - Intergenic
1034964918 7:155384889-155384911 CTGCTCTGTCTACGGTGTTTGGG + Intronic
1035852211 8:2931884-2931906 CTACTTTCTTCACATTGTATTGG + Intergenic
1036671215 8:10789561-10789583 CTGCCCTGTCTACATTGCAAGGG - Intronic
1038701024 8:29849380-29849402 CTGATCTCTCCATTTTGTATAGG - Intergenic
1040556209 8:48479282-48479304 CTTCTCTCTCTTCATTCTCTTGG - Intergenic
1042493617 8:69431025-69431047 CTGCTCTCTCATCATTTTTTAGG + Intergenic
1043924863 8:86025558-86025580 CTGGTCTCACTACATTGCCTAGG - Intronic
1046611477 8:116430291-116430313 GAGCTCTCTCCACATTGTGTTGG - Intergenic
1047658004 8:126999906-126999928 TTGCTCTATATACATTGTATGGG + Intergenic
1050796609 9:9553552-9553574 ATGCTCTTTCTACAGTGTTTTGG + Intronic
1052425635 9:28301302-28301324 CTGCTCTCTAGATATAGTATAGG + Intronic
1056187990 9:84155145-84155167 CAGCTCTCTTCCCATTGTATTGG - Intergenic
1056205765 9:84317911-84317933 CTGATCTCTCAAAATTGTTTGGG + Intronic
1058377138 9:104335857-104335879 TTACTTTCTCTACATTATATGGG - Intergenic
1058492087 9:105513758-105513780 CTGCTCTGTGTAGACTGTATTGG + Intronic
1060433639 9:123573233-123573255 CTTCTCTTTCAACATTGTTTTGG + Intronic
1061933258 9:133844132-133844154 CTGCCCCCTCTACTTTGTCTGGG + Intronic
1189718441 X:43889178-43889200 CTTCTCTCTCAAGATTGTTTTGG + Intergenic
1189736634 X:44077599-44077621 CTTCTTTTTCAACATTGTATTGG - Intergenic
1191953758 X:66622436-66622458 ATGCTCTCTCTATGTAGTATGGG + Intronic
1192551094 X:72054170-72054192 CTCCTCTGTCTACACTGTGTGGG + Intergenic
1199204434 X:145131837-145131859 CTGATCTCTTTATATTGTTTTGG - Intergenic
1201010155 Y:9543842-9543864 TTGCTCTTTCTACTTTATATGGG - Intergenic