ID: 1184181512

View in Genome Browser
Species Human (GRCh38)
Location 22:42831007-42831029
Sequence ACAGAAGGGTCGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 2, 3: 73, 4: 545}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184181503_1184181512 19 Left 1184181503 22:42830965-42830987 CCCCCACTTTATAGTCTATTATG 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG 0: 1
1: 0
2: 2
3: 73
4: 545
1184181505_1184181512 17 Left 1184181505 22:42830967-42830989 CCCACTTTATAGTCTATTATGAA 0: 1
1: 0
2: 3
3: 25
4: 300
Right 1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG 0: 1
1: 0
2: 2
3: 73
4: 545
1184181504_1184181512 18 Left 1184181504 22:42830966-42830988 CCCCACTTTATAGTCTATTATGA 0: 1
1: 0
2: 0
3: 13
4: 200
Right 1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG 0: 1
1: 0
2: 2
3: 73
4: 545
1184181506_1184181512 16 Left 1184181506 22:42830968-42830990 CCACTTTATAGTCTATTATGAAT 0: 1
1: 0
2: 2
3: 27
4: 317
Right 1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG 0: 1
1: 0
2: 2
3: 73
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184181512 Original CRISPR ACAGAAGGGTCGGCCAGGTG TGG Intronic
900126934 1:1072880-1072902 GCAGCAGGGCCAGCCAGGTGGGG - Intronic
900265494 1:1755107-1755129 ACAGAAGTGTCGGCCGGGCGCGG - Intronic
900271119 1:1789400-1789422 ACAGAGGGCTGGGCCGGGTGCGG + Intronic
900782390 1:4626601-4626623 AAGGAAGGGCAGGCCAGGTGTGG + Intergenic
901000562 1:6146880-6146902 AGAGAAGGGTCCCCAAGGTGGGG + Intronic
901153083 1:7117259-7117281 AAAGAAAGATAGGCCAGGTGTGG - Intronic
901522544 1:9796384-9796406 AAAGATGGGTGGGCCAGGCGCGG + Intronic
901755142 1:11436927-11436949 CTAGGAGGGTCGGCTAGGTGGGG + Intergenic
901990765 1:13111865-13111887 AAAAAAGATTCGGCCAGGTGTGG + Intergenic
902210804 1:14903157-14903179 AAATAAGAGGCGGCCAGGTGTGG - Intronic
902839055 1:19064007-19064029 CTCGAAGGGTTGGCCAGGTGCGG - Intergenic
903104027 1:21058857-21058879 ATAGAAAGTTTGGCCAGGTGTGG - Intronic
903121661 1:21220203-21220225 ACAGCAGGGGAGGCCAGGTGCGG + Intronic
903496091 1:23768321-23768343 AGAAAATGGCCGGCCAGGTGCGG + Intergenic
903659627 1:24969197-24969219 AGAGAAGGGCCTGCCAGCTGAGG + Intergenic
903873414 1:26454241-26454263 ACAAAGGGGTTGGCCAGGCGCGG - Intronic
903949771 1:26989559-26989581 ACACAAGGGTAGGCCGGGTGCGG - Intergenic
904202649 1:28831219-28831241 AGAGAGGGCTCGGCCTGGTGTGG + Intronic
904740944 1:32675477-32675499 AAAGAAGGATGGGCCAGGTGCGG + Intronic
904815911 1:33198214-33198236 AGAGAAAAGTCGGCCAAGTGTGG + Intergenic
904919412 1:33995232-33995254 ACAGCAGAGTCGTCCAAGTGTGG - Intronic
905209941 1:36367136-36367158 GTAGAAGAGTTGGCCAGGTGTGG - Intronic
905593653 1:39186898-39186920 ACAGAAATGTGGCCCAGGTGTGG - Intronic
905722697 1:40219954-40219976 ACAGAAGTACTGGCCAGGTGCGG + Intronic
907364879 1:53949812-53949834 GCAGAAGGGTCTGGCAAGTGGGG + Intronic
907669189 1:56459862-56459884 AAGGATGAGTCGGCCAGGTGTGG - Intergenic
908431122 1:64059418-64059440 AGAGAAGTCTCAGCCAGGTGCGG + Intronic
909012592 1:70351688-70351710 ACAGCAAGCTTGGCCAGGTGCGG - Intronic
909998493 1:82311586-82311608 ACAGACAGATGGGCCAGGTGCGG - Intergenic
910401467 1:86842116-86842138 ACAAAAAGTTGGGCCAGGTGAGG + Intergenic
910966273 1:92811055-92811077 AGAGGAGGGTCGGCCGGGCGCGG - Intergenic
913247331 1:116881602-116881624 TTAGAAGTCTCGGCCAGGTGCGG - Intergenic
914822112 1:151112629-151112651 CCAGCATAGTCGGCCAGGTGCGG - Intronic
914927296 1:151899200-151899222 AGTGAAGGGAGGGCCAGGTGTGG + Intronic
915015279 1:152727365-152727387 ACTACAGGGTAGGCCAGGTGAGG + Intergenic
915571923 1:156749584-156749606 ACAGAAGGGAAGGACAGGGGAGG - Intronic
916085771 1:161268001-161268023 ATAGTATTGTCGGCCAGGTGCGG - Intronic
916867727 1:168878374-168878396 ATAAAAGTGTTGGCCAGGTGTGG - Intergenic
917521740 1:175753473-175753495 AAAGAAAGGTGGGGCAGGTGGGG - Intergenic
917857961 1:179117123-179117145 ACAGAAGTATAGGCCTGGTGTGG - Intronic
918304820 1:183236231-183236253 AAAAAAGGGGGGGCCAGGTGTGG + Intronic
918503348 1:185223469-185223491 AGAAAAGTGTTGGCCAGGTGCGG - Intronic
919622193 1:199875602-199875624 ACTGAATGGGAGGCCAGGTGTGG + Intergenic
919906752 1:202083818-202083840 AAAAAAGAATCGGCCAGGTGCGG - Intergenic
920002702 1:202810823-202810845 AAAGAAGGGCCGGCGCGGTGTGG - Intergenic
920012189 1:202876726-202876748 ACATAAAAATCGGCCAGGTGCGG + Intergenic
920344722 1:205298871-205298893 AGGGAAGGGTGGGCAAGGTGAGG - Intergenic
920385764 1:205569348-205569370 AGGGAAGGGTCGGCCCGGCGAGG - Intronic
920510282 1:206546260-206546282 ACAAAAAAGTCAGCCAGGTGTGG - Intronic
920532433 1:206713574-206713596 ACAGAAGAGTAGGCCAGGCATGG + Intronic
920957152 1:210630129-210630151 ACAGAGGAGGAGGCCAGGTGCGG - Intronic
921644297 1:217595788-217595810 TAAGAAGGATCGGCCGGGTGCGG - Intronic
922075938 1:222244635-222244657 ATAGTAGGGTGGGCCGGGTGCGG + Intergenic
922480034 1:225933753-225933775 ACAAAAGAGTTGGCCAGGTGTGG - Intergenic
922725482 1:227921058-227921080 ACAGCAGGGTTGGCCAGGCCCGG + Exonic
923316232 1:232783061-232783083 AAAGAAGACTTGGCCAGGTGCGG - Intergenic
924263828 1:242260056-242260078 AGAGAATTGTTGGCCAGGTGGGG + Intronic
924540459 1:244975976-244975998 ACATAAGAGTTGGCCAGGCGTGG + Intronic
924599573 1:245476814-245476836 ATAAAAGGGGTGGCCAGGTGCGG - Intronic
924616278 1:245614461-245614483 ACTGAAGGAGAGGCCAGGTGCGG - Intronic
924743321 1:246810538-246810560 AAAGAAAAGCCGGCCAGGTGCGG - Intergenic
1063637153 10:7793400-7793422 ACAGATGGCAGGGCCAGGTGCGG - Intronic
1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG + Intergenic
1064983789 10:21189755-21189777 ACAGAAGGCTGGGCCAGGCGCGG - Intergenic
1065523868 10:26597835-26597857 ATAGAAGTGGAGGCCAGGTGCGG + Intergenic
1066396639 10:35030671-35030693 AAAGTAGTGTTGGCCAGGTGTGG - Intronic
1066720970 10:38338416-38338438 AGAGAATTGTTGGCCAGGTGGGG - Intergenic
1067000268 10:42604620-42604642 ACAAAAGACTTGGCCAGGTGGGG + Intronic
1067124299 10:43502738-43502760 AAAAAAGGGCAGGCCAGGTGCGG + Intergenic
1067796860 10:49327153-49327175 AGAGCAGGGTGGGCCAGGAGAGG - Exonic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1069510039 10:69035368-69035390 ACAGAAGGCCCGGCTTGGTGCGG + Intergenic
1069975630 10:72210448-72210470 AAAGAGGTTTCGGCCAGGTGCGG - Intronic
1070029354 10:72662114-72662136 AGAGCAGTGTAGGCCAGGTGCGG - Intergenic
1070147840 10:73787559-73787581 ATAAAGGGGTTGGCCAGGTGCGG + Intronic
1070903951 10:80055269-80055291 ACAGTATGGTGGGCCAGGCGTGG + Intergenic
1070999467 10:80816409-80816431 ACCCAAAGGTTGGCCAGGTGTGG + Intergenic
1071102862 10:82059779-82059801 GCAGAAGGGTCTCCCAGGGGAGG - Intronic
1072250440 10:93578124-93578146 AAAGAAGAGCAGGCCAGGTGTGG + Intronic
1072942757 10:99781755-99781777 ACAAAAGGTTGGGTCAGGTGGGG + Intergenic
1073034547 10:100554344-100554366 ATATAAGTGTTGGCCAGGTGTGG + Exonic
1073131853 10:101194524-101194546 AGATATGGGCCGGCCAGGTGTGG + Intergenic
1073251902 10:102125412-102125434 ACAAAAGATTTGGCCAGGTGTGG - Intergenic
1074024136 10:109616103-109616125 TAAGAAGTGTGGGCCAGGTGTGG - Intergenic
1075049265 10:119170602-119170624 AAAAAATGGTCTGCCAGGTGCGG + Intronic
1075696513 10:124439859-124439881 AGAGAAGAGATGGCCAGGTGCGG - Intergenic
1075700086 10:124463651-124463673 AGAAAAGTGTCAGCCAGGTGCGG - Intronic
1075803804 10:125170727-125170749 ACAGAAATATTGGCCAGGTGTGG + Intergenic
1077203289 11:1325217-1325239 AAAGAAGGGGCGGCAGGGTGTGG + Intergenic
1078110420 11:8387795-8387817 ACTGAAGGGTGGGGCGGGTGGGG - Intergenic
1078162402 11:8853071-8853093 AAAGAAGCTTCGGCCAGGCGCGG + Intronic
1078738857 11:14047947-14047969 TAATAAGGGTGGGCCAGGTGTGG + Intronic
1078827137 11:14940133-14940155 ACAGAAAATTGGGCCAGGTGTGG - Intronic
1081156987 11:39705185-39705207 GGAAAAGGATCGGCCAGGTGCGG - Intergenic
1081369727 11:42284860-42284882 AAAGATGGCTCGGCCAGGCGCGG + Intergenic
1081503816 11:43694408-43694430 AGTGAAAGGTTGGCCAGGTGTGG + Intronic
1082851118 11:57765756-57765778 ATATAAGGGAGGGCCAGGTGTGG - Intronic
1082985365 11:59165076-59165098 ACATAAGGATCGGCCGGGCGCGG + Intergenic
1083300776 11:61738721-61738743 GCAGACGGGGTGGCCAGGTGGGG + Intronic
1083575287 11:63786284-63786306 ACAGAAAGAGCGGCCAGGCGCGG + Intergenic
1083835602 11:65264938-65264960 TCAAAAGGGTCGGCCGGGTGCGG + Intronic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1083943037 11:65908256-65908278 GCATAAGAGTCAGCCAGGTGAGG - Intergenic
1084131590 11:67139992-67140014 ACACAGGAGTAGGCCAGGTGCGG - Intronic
1084184777 11:67465633-67465655 CAAAAAGGGTGGGCCAGGTGTGG + Intronic
1084285552 11:68128465-68128487 TCAGAAGGGGCGGGCAGGGGCGG + Intergenic
1084491117 11:69478962-69478984 AAACAAGTGTGGGCCAGGTGCGG + Intergenic
1084745366 11:71166771-71166793 AAAGAAGTGTGGGCCCGGTGTGG - Intronic
1085061270 11:73449258-73449280 ACAGTAGCTTAGGCCAGGTGCGG - Intronic
1085202567 11:74710635-74710657 ACAGAAGGCTCAGGAAGGTGTGG + Intronic
1085604546 11:77885365-77885387 AAATAAGGGTAGGCCAGGTGTGG - Intronic
1087167093 11:95015587-95015609 AAAGAATGTTTGGCCAGGTGCGG - Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1088024697 11:105163694-105163716 AGAGAAGGGCAGGCCAGGGGTGG + Intergenic
1088635690 11:111818067-111818089 ATAGAAGTGAGGGCCAGGTGTGG - Intronic
1089246955 11:117128720-117128742 AAAGCAGCATCGGCCAGGTGTGG + Intergenic
1090048292 11:123355883-123355905 AGAGAAGGAAAGGCCAGGTGTGG + Intergenic
1092064463 12:5578323-5578345 GCAGAAGGATGGGCCTGGTGGGG + Intronic
1092326949 12:7542782-7542804 ACAGAACTGAAGGCCAGGTGAGG + Intergenic
1092372248 12:7926379-7926401 AGAGAAAGGAGGGCCAGGTGCGG - Intronic
1092460036 12:8678304-8678326 AAAGAAAGACCGGCCAGGTGTGG - Intergenic
1092524756 12:9302801-9302823 TAAGAAGGGTCGGCCGGGTGTGG + Intergenic
1092542508 12:9429010-9429032 TAAGAAGGGTCGGCCAGGTGTGG - Intergenic
1092825238 12:12392936-12392958 AAAAAAAGGTCGGCCAGGTGTGG + Intronic
1093946206 12:25112694-25112716 ACAGATGTGTAGGCTAGGTGTGG - Intronic
1094224592 12:28030848-28030870 AGAGAAGTGTTGGCCAGGCGCGG + Intergenic
1094510503 12:31093423-31093445 TAAGAAGGGTCGGCCGGGTGCGG + Intronic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1095423868 12:42054066-42054088 TCAGAAGGGTTGGACAGCTGGGG - Intergenic
1096250090 12:50025412-50025434 AGTGAAGGGTGGCCCAGGTGGGG - Exonic
1096297265 12:50394211-50394233 ACAGAGTGCTTGGCCAGGTGTGG - Intronic
1096414163 12:51399037-51399059 ACAGAAACTTCAGCCAGGTGTGG - Intronic
1096523330 12:52196366-52196388 AAAAAAGGGGGGGCCAGGTGCGG - Intergenic
1096556572 12:52407645-52407667 ACAGCAGGGAAGCCCAGGTGAGG + Intergenic
1096704232 12:53408614-53408636 AAAGAAGGCTTGGCCGGGTGCGG + Intronic
1096750544 12:53756159-53756181 CCAGAAGGACCGGCCAGGTGGGG + Intergenic
1097666291 12:62481234-62481256 ACTGATGGCTCGGCCAGGCGTGG + Intronic
1098321229 12:69245793-69245815 ATGGAAGTGTAGGCCAGGTGCGG + Intronic
1098334880 12:69393310-69393332 ACAGAAAAATTGGCCAGGTGTGG + Intergenic
1098912399 12:76222469-76222491 GAAGAAGGGTCTGACAGGTGTGG + Intergenic
1102439142 12:112948203-112948225 AAAGCAGGGGTGGCCAGGTGTGG + Intronic
1103756694 12:123213147-123213169 ACAGAATGGTCAGCCAGGCGCGG - Intronic
1103789095 12:123456795-123456817 GCATAGGGGTCAGCCAGGTGTGG + Intergenic
1104143429 12:126009757-126009779 ACAGGAAGGATGGCCAGGTGTGG + Intergenic
1104355801 12:128085921-128085943 ATAGAAGGTTAGGCCAGGCGTGG - Intergenic
1105374135 13:19828181-19828203 GCAGAGGTGTGGGCCAGGTGCGG + Intronic
1105457388 13:20554235-20554257 ACGCTAGGGTGGGCCAGGTGCGG + Intergenic
1105763737 13:23537475-23537497 ATATAAGGCTAGGCCAGGTGCGG + Intergenic
1108097485 13:46918875-46918897 ACAGCATGGTAGGCCAGGCGCGG - Intergenic
1110611448 13:77492462-77492484 ATGCAAGGGTCGGCCAGGCGTGG + Intergenic
1111858902 13:93676259-93676281 ACACAAAAGTCAGCCAGGTGTGG + Intronic
1111874689 13:93878666-93878688 TCTGAAGGGTAGGCCAGGAGCGG - Intronic
1111890238 13:94072640-94072662 ATACAAGGGGCGGCCGGGTGTGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1115230277 14:31153100-31153122 AGAGATGGGTCGGCCAGGCGTGG + Intronic
1115343874 14:32321593-32321615 AAACACTGGTCGGCCAGGTGTGG + Intergenic
1116810836 14:49538571-49538593 GCAGAATGCTGGGCCAGGTGTGG + Intergenic
1116837192 14:49781080-49781102 AAATGAGGGTCGGCCAGGCGTGG + Intronic
1116947192 14:50846864-50846886 TAAAAAGGGTAGGCCAGGTGCGG + Intergenic
1117418736 14:55522953-55522975 ACAGATGAATGGGCCAGGTGCGG + Intergenic
1117803748 14:59469262-59469284 AAAGAAGGGGAGGCCAGGCGCGG + Intronic
1117999993 14:61514170-61514192 GCAGACGGGTCAGCCAGGTTGGG - Intronic
1118170351 14:63382689-63382711 TTAGAAGGGCAGGCCAGGTGTGG - Intronic
1118264038 14:64277333-64277355 ACATAAGAATGGGCCAGGTGCGG + Intronic
1118602974 14:67483299-67483321 AATGTAGGCTCGGCCAGGTGTGG - Intronic
1118636296 14:67751534-67751556 AAAGAAGAGTCAGCCGGGTGTGG - Intronic
1119763855 14:77175605-77175627 ATAAATGGGTTGGCCAGGTGTGG - Intronic
1119815099 14:77559027-77559049 AAAGAAGCATCAGCCAGGTGTGG + Intronic
1120360810 14:83499526-83499548 ACATAAGTGTGGGCCAGGTGTGG - Intergenic
1122487672 14:102092222-102092244 ACAAAAAAGTCAGCCAGGTGTGG - Intronic
1122676669 14:103420519-103420541 AAAAAAGTGTTGGCCAGGTGTGG - Intronic
1123914288 15:25006344-25006366 ATAGAGGTGTGGGCCAGGTGTGG - Intergenic
1124205729 15:27718427-27718449 ACACAAGTGTTGGCCAGATGAGG - Intergenic
1125359503 15:38850273-38850295 AGAGAAGGGGAGGCCAGGTAGGG + Intergenic
1125847849 15:42874605-42874627 AAAGCAGGATCGGCCGGGTGTGG - Intronic
1125890517 15:43262164-43262186 AAAGAAGGGTGGGCCAACTGAGG - Intronic
1125964057 15:43858534-43858556 ACAGAACTCTCAGCCAGGTGCGG - Intronic
1126024501 15:44432910-44432932 ACACAGGAATCGGCCAGGTGCGG - Intronic
1126754875 15:51916358-51916380 AGAGCAGGGTCGGACAGGTGCGG + Intronic
1127062741 15:55203710-55203732 AGAGCAGGGTTGGCCAGGCGCGG - Exonic
1127368277 15:58311274-58311296 AAAAAAGGGAAGGCCAGGTGCGG + Intronic
1127379987 15:58422473-58422495 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1127780054 15:62304857-62304879 AAAGAACTGTTGGCCAGGTGCGG + Intergenic
1128612255 15:69083630-69083652 ACAAGAGAGTGGGCCAGGTGTGG - Intergenic
1128860917 15:71071190-71071212 ACAGAAAGGTTGGGGAGGTGGGG + Intergenic
1129009667 15:72404121-72404143 TCAGAAGAATCTGCCAGGTGTGG + Intronic
1129041736 15:72692886-72692908 ACAGATAGATCAGCCAGGTGTGG - Intronic
1130249367 15:82287185-82287207 AAAGAAGTCTTGGCCAGGTGTGG - Intergenic
1130866978 15:87941605-87941627 AGAGAAGGGTTGGCCAAGTAGGG - Intronic
1131026266 15:89144421-89144443 ACTGAATGGTAGGCCCGGTGTGG - Intronic
1132383769 15:101385306-101385328 AGAAAAAGGTGGGCCAGGTGTGG - Intronic
1132818054 16:1844412-1844434 ACAGAATGCTTGGCCAGGTGTGG - Intronic
1132832620 16:1936361-1936383 AAAGCAGGGGAGGCCAGGTGTGG - Intergenic
1133090971 16:3403459-3403481 ACAAAAAGCTAGGCCAGGTGTGG - Intronic
1133263988 16:4572136-4572158 ATGGAGGGGTCGGCCAGGTATGG - Intronic
1133287983 16:4699367-4699389 ACACTATGGTCGGCCACGTGGGG + Intronic
1133794685 16:9036424-9036446 AGAGAAGGGTCAGCTGGGTGTGG + Intergenic
1135110010 16:19683211-19683233 TAAGAAGGGAAGGCCAGGTGTGG - Intronic
1135126732 16:19816572-19816594 AAAGAAGTGTTGGCCAGGCGCGG - Intronic
1135238797 16:20784094-20784116 AGAGAAGGAAAGGCCAGGTGTGG - Intronic
1135793606 16:25421189-25421211 ACAGAAAAATGGGCCAGGTGTGG - Intergenic
1135875725 16:26198349-26198371 GCAGCAGAGCCGGCCAGGTGAGG - Intergenic
1136131237 16:28223085-28223107 ACTGAAAGGTGGGCCAGGCGTGG - Intergenic
1136178245 16:28533319-28533341 AGAGGAGGGTCGGCCTGGGGTGG + Intronic
1136455526 16:30377914-30377936 ACAGAAGCGTCGGGCAGCGGAGG - Exonic
1137400082 16:48146267-48146289 ACAGAAGGGAGGGCCAGGGCAGG - Intronic
1138511117 16:57508877-57508899 TCAGGAGCGTGGGCCAGGTGCGG + Intergenic
1139850564 16:69949681-69949703 ACAGGTGGCTTGGCCAGGTGTGG + Intergenic
1139879548 16:70172593-70172615 ACAGGTGGCTCGGCCAGGTGTGG + Intergenic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140238724 16:73182164-73182186 ACAGTAGGGAGGGCCGGGTGAGG + Intergenic
1140293091 16:73682493-73682515 AAAGAAAGGTAGGCCGGGTGCGG + Intergenic
1140372976 16:74422955-74422977 ACAGGTGGCTCGGCCAGGTGTGG - Intergenic
1140536671 16:75715986-75716008 ACAGAAATGTGGGCCAGATGTGG - Intronic
1140762060 16:78118617-78118639 CCAGAAGAGTCGCCCAGTTGTGG + Intronic
1141428236 16:83957257-83957279 ACAGAAGGGTCTGGCAGGGCTGG + Intronic
1142016091 16:87748476-87748498 ACAGAAGCCTGGGCCGGGTGTGG - Intronic
1142301493 16:89261156-89261178 AAAGAAAAGTCGGCCGGGTGCGG + Intergenic
1143510308 17:7391893-7391915 ACTCAAGGGTCGGTCAGGTGCGG + Intronic
1144206730 17:12984722-12984744 ACAGAAGGAGAGGCCAGGGGAGG - Exonic
1144507093 17:15841330-15841352 AGTGAAATGTCGGCCAGGTGCGG - Intergenic
1144547196 17:16208346-16208368 ACAGAACGGTTGGCCAGGCATGG - Intronic
1144604310 17:16651272-16651294 ACAAAATGATCAGCCAGGTGTGG + Intronic
1144644395 17:16962214-16962236 AAAGAAAGGTAGGCCAGGTGTGG + Intronic
1144867077 17:18343316-18343338 ACATATGGGTCAGCCAGGCGTGG + Intronic
1145098910 17:20057149-20057171 ACAGAAAGGTTGGCCGGGTGCGG + Intronic
1145171219 17:20658927-20658949 AGTGAAATGTCGGCCAGGTGCGG - Intergenic
1146594315 17:34156135-34156157 ACGGAGGGGTCAGCCAGATGGGG + Intronic
1146709439 17:35028042-35028064 AAAGAAGCGTTGGCCAGGTGTGG + Intronic
1146885921 17:36470880-36470902 GCAGAAGGGTAGTCCAGGGGAGG + Intergenic
1146949498 17:36895970-36895992 ACTGAAGAGTCTGCCAGGGGTGG + Intergenic
1147173247 17:38634160-38634182 TTAGAATGGTCGGCCAGGCGTGG + Intergenic
1147407427 17:40222340-40222362 AGAGACAGGTCGGCCAGGCGCGG - Intronic
1147502249 17:40976632-40976654 ACACAAGGAAAGGCCAGGTGGGG - Intergenic
1147884135 17:43673331-43673353 CCCGAAGGCTCGGCCGGGTGCGG - Intergenic
1148737232 17:49871616-49871638 ACAGAAGGGTCCCCCAGGTCAGG - Intergenic
1148740298 17:49889062-49889084 TCAGGAGGGTAGGCCGGGTGCGG + Intergenic
1149786072 17:59436170-59436192 ATAGAATGGTGGGCCAGGCGCGG - Intergenic
1150634733 17:66905008-66905030 ACAGAAGGAGAGGCCAGGAGGGG + Intergenic
1150912673 17:69405250-69405272 AAAAAAGGATTGGCCAGGTGTGG - Intergenic
1151673320 17:75585009-75585031 TCAGATGGGTCGTCCAGGTGGGG - Intergenic
1152449576 17:80368721-80368743 CCAGTGGCGTCGGCCAGGTGTGG - Intronic
1154241242 18:12656187-12656209 ACAGCAATGTCTGCCAGGTGCGG - Intronic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1155584152 18:27345571-27345593 ATAGAAGGCTAGGCAAGGTGGGG - Intergenic
1155972449 18:32093910-32093932 AAAGAATGTTCGGGCAGGTGGGG + Intronic
1156559472 18:38106221-38106243 ACAGAAGTGTGGGCAAGGTCAGG - Intergenic
1157483086 18:48068427-48068449 AGACAAGGCTCAGCCAGGTGCGG - Intronic
1157599159 18:48883144-48883166 AAAGAAGGAGAGGCCAGGTGTGG + Intergenic
1157725318 18:49959477-49959499 ACAGCAGGCTGGGCCAGGTGAGG + Intronic
1157725917 18:49963716-49963738 ATAGAAGGTAAGGCCAGGTGTGG - Intronic
1159308538 18:66677651-66677673 ACAGGAGAGTCGGCCGGGCGCGG - Intergenic
1160767530 19:815089-815111 GCGGAAGGCTCGGCCAGGCGGGG + Intronic
1161020680 19:2009861-2009883 AAAGGAGGGGAGGCCAGGTGCGG + Intronic
1161321542 19:3643876-3643898 ATAGAAGGCTCCACCAGGTGGGG - Intronic
1161636297 19:5391359-5391381 ACAGAAAGGAGGGCCAGGTGCGG - Intergenic
1162181337 19:8871168-8871190 ACAGAAGAGTCTTCCTGGTGGGG - Intronic
1162244384 19:9387301-9387323 AAAGAAAGATCAGCCAGGTGTGG + Intergenic
1162526449 19:11209474-11209496 AGTGAAGGGACGGACAGGTGAGG - Intronic
1162526767 19:11210759-11210781 GCTGAAGGGATGGCCAGGTGAGG - Intronic
1162934355 19:13973920-13973942 AAGACAGGGTCGGCCAGGTGTGG - Intronic
1163353381 19:16793865-16793887 ACATAAAAGTTGGCCAGGTGTGG - Intronic
1163360877 19:16845561-16845583 ACAGAAGGCAAGGCCAGGTGCGG - Intronic
1163729864 19:18942578-18942600 ACTCAAGTGTCGGCCAGGTGTGG - Intergenic
1163855112 19:19695505-19695527 AAAGAATAGCCGGCCAGGTGCGG - Intergenic
1164077724 19:21835643-21835665 ACAGGAGAGTCGGCCGGGCGCGG - Intronic
1164109534 19:22142522-22142544 AAAGAAAAGTTGGCCAGGTGTGG - Intergenic
1164779954 19:30884257-30884279 AAAGAAGTGGGGGCCAGGTGTGG - Intergenic
1165059928 19:33200151-33200173 ACAGAAGGGAAGGCCCAGTGAGG - Intronic
1165342258 19:35221398-35221420 ATACAAGAGTTGGCCAGGTGTGG - Intergenic
1165372141 19:35415272-35415294 AGAGAAGGGCTGGCCAGGTGCGG - Intergenic
1166009660 19:39933107-39933129 ACAGAAAGAACGGCCAGGCGTGG - Intronic
1166093069 19:40522839-40522861 ACAGGAGGGTTGGCTGGGTGTGG + Intronic
1166274647 19:41744378-41744400 ATAGAAGGCAGGGCCAGGTGTGG + Intronic
1166547955 19:43645462-43645484 ACAGAAACTTAGGCCAGGTGTGG - Intergenic
1167634638 19:50647393-50647415 CCAGGAGGCTGGGCCAGGTGTGG + Intronic
1167778371 19:51577951-51577973 AGAGAGGGGTATGCCAGGTGCGG - Intronic
1167950877 19:53026719-53026741 AAAAAAGTGTAGGCCAGGTGTGG + Intergenic
1168554076 19:57323480-57323502 ACAGCAGTGTCGGTCAGGCGCGG - Intronic
1168693839 19:58394089-58394111 ACAAAAAAGGCGGCCAGGTGTGG - Intronic
925204313 2:1993282-1993304 ACACAGGGGTCCGCCAGGTGGGG + Intronic
925327411 2:3034505-3034527 ACAGAAGGCTGGGCCAGGCGGGG - Intergenic
926463328 2:13161070-13161092 ACAGAAGAAGAGGCCAGGTGTGG + Intergenic
926569051 2:14509445-14509467 CCAGAAGGGTGGGCCAGGCACGG - Intergenic
927523891 2:23720281-23720303 CCAGGAGGGCAGGCCAGGTGTGG + Intergenic
927540447 2:23906044-23906066 AGAGAAAGGTCGGCTGGGTGCGG + Intronic
927666678 2:25037738-25037760 ACAGAAGGGCTGGCCAGGTATGG - Intergenic
927690764 2:25206592-25206614 AAAGAGGGGAAGGCCAGGTGCGG + Intergenic
928306101 2:30171650-30171672 AAAAAAAAGTCGGCCAGGTGCGG + Intergenic
930550906 2:52833767-52833789 AAAGAAGAGTCGGCCAGGCTTGG + Intergenic
930772910 2:55145604-55145626 ACATCAGAGTTGGCCAGGTGCGG + Intergenic
930777156 2:55184393-55184415 ACAGGAATGTTGGCCAGGTGTGG - Intronic
930914743 2:56672823-56672845 ACAGAAGGTTGGGACAGGTCAGG + Intergenic
931083894 2:58807558-58807580 GCAGAAGGGCAGGACAGGTGCGG - Intergenic
931367470 2:61631346-61631368 ACAGAAGAGTTAGCCAGGCGTGG - Intergenic
931394976 2:61879566-61879588 TGAGAAGTATCGGCCAGGTGCGG - Intronic
931866528 2:66418347-66418369 AAAACAGGGTCGGCCAGGCGCGG + Intergenic
931999920 2:67875808-67875830 ACTGCAGGATAGGCCAGGTGTGG + Intergenic
932411594 2:71550998-71551020 TCAGAGGGGTCGGCCCAGTGGGG - Intronic
932463114 2:71896038-71896060 ACAGGAGAGTTAGCCAGGTGTGG - Intergenic
932625692 2:73293829-73293851 ACCGGACGGTCGGCCCGGTGAGG - Intergenic
933108920 2:78372730-78372752 GCAAAAGCTTCGGCCAGGTGCGG + Intergenic
933520662 2:83368150-83368172 AAAGAAGGGTAGGCCGGGCGCGG + Intergenic
935788682 2:106571280-106571302 ACAGGAGGGAAGGCCAAGTGTGG + Intergenic
936488109 2:112944431-112944453 AGATAAGTGTTGGCCAGGTGTGG - Intergenic
936493698 2:112998835-112998857 AGAGAAGGAAAGGCCAGGTGCGG + Intergenic
937070699 2:119060980-119061002 ACAGAAAGCTGGGGCAGGTGAGG - Intergenic
938120311 2:128628478-128628500 ACAGCAGGTTGGGCCACGTGGGG - Intergenic
939663364 2:144918594-144918616 AGACATGGGTAGGCCAGGTGTGG - Intergenic
940076933 2:149751957-149751979 ACAGACATGTAGGCCAGGTGTGG - Intergenic
940278422 2:151963775-151963797 AAAGAATGTTGGGCCAGGTGCGG + Intronic
941659392 2:168180054-168180076 ACACAAGTATCAGCCAGGTGCGG + Intronic
942280275 2:174356060-174356082 AAAGAATGATGGGCCAGGTGTGG - Intronic
942939644 2:181601267-181601289 AGAGAAGTGCCAGCCAGGTGCGG + Intronic
943567279 2:189530879-189530901 TGAGAAGGGTTGGCCAGATGGGG + Intergenic
944066411 2:195624093-195624115 AAAGAAGGCCTGGCCAGGTGCGG + Intronic
944080727 2:195785199-195785221 AAAAATGGGTCGGCCGGGTGCGG - Intronic
944622520 2:201531247-201531269 ACTGCAGGGTCGGCCAGGCGCGG - Intronic
944664307 2:201946961-201946983 AGAGAAAGGTCGGCCAGGCGCGG + Intergenic
944795120 2:203176432-203176454 ACAGTAAAGTAGGCCAGGTGTGG + Intronic
945472107 2:210239053-210239075 AAAGAGAGGTAGGCCAGGTGTGG - Intergenic
945620745 2:212133672-212133694 ACATAAAGGAAGGCCAGGTGTGG + Intronic
946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG + Intergenic
947296070 2:228631970-228631992 TCAGGAAGGTCGGCCGGGTGTGG + Intergenic
947640283 2:231703797-231703819 ACAGAGAGGACGGCCAGGTGTGG - Intergenic
947792500 2:232876190-232876212 GGAGAAGGGCCGGCCAGGCGGGG + Intronic
948463342 2:238140650-238140672 AGAGCAGGGTCAGCCAAGTGGGG - Intronic
949005511 2:241644657-241644679 TCAGAAGTGTCGGCCGGTTGCGG + Intronic
1168783667 20:518119-518141 AAAGATGAGTGGGCCAGGTGTGG - Intronic
1170212133 20:13856040-13856062 ACAGAAAGGATGGCCAGGAGGGG + Intronic
1170241374 20:14170180-14170202 AAAGAAGTGTTGGCCGGGTGTGG - Intronic
1171051362 20:21862319-21862341 ACTGAAGGGATGGACAGGTGGGG + Intergenic
1171982154 20:31635767-31635789 ACAGAAGAGACAGCCAGGTGCGG - Intergenic
1172250885 20:33478292-33478314 AGAGAAGGGTATGCCAGGGGAGG - Intergenic
1172269809 20:33648336-33648358 ACATTATGGTCGGCCAAGTGAGG + Exonic
1172928090 20:38559402-38559424 ACAGAAGGACTGGCCGGGTGTGG + Intronic
1173107543 20:40151940-40151962 ATAGCAGGCTAGGCCAGGTGTGG - Intergenic
1173808606 20:45942262-45942284 AAAAAAGGGTGGGCCGGGTGCGG - Intronic
1173817073 20:45996572-45996594 AAAGAAAGTTTGGCCAGGTGCGG - Intergenic
1174067990 20:47879399-47879421 AGAGAAGACTCGGCCAGGTGTGG - Intergenic
1174432309 20:50479229-50479251 ACACAAGCGACGGCCAGGTGCGG - Intergenic
1174681275 20:52411139-52411161 ACGTAAGGGTGGGCCTGGTGTGG - Intergenic
1174863086 20:54110975-54110997 AAAGAAAGGTGGGCCGGGTGCGG + Intergenic
1174931123 20:54816158-54816180 ACATCAGGGTCTGCCAGGGGTGG + Intergenic
1175104818 20:56607368-56607390 AAAGAAGACTGGGCCAGGTGCGG + Intergenic
1175187955 20:57191405-57191427 AAAGAAATGTAGGCCAGGTGTGG + Intronic
1175190457 20:57208891-57208913 ACAGAAAGTAGGGCCAGGTGTGG + Intronic
1175438723 20:58974890-58974912 ATAGAAACCTCGGCCAGGTGCGG + Intergenic
1175522763 20:59612672-59612694 ACAGGATGGTCAGCCAGGCGCGG - Intronic
1176092575 20:63325635-63325657 ACAGAGGGGCCGGCCAGGCAGGG - Intronic
1176250021 20:64116217-64116239 CCAGAAGCCTCGGCCAGATGAGG - Intergenic
1176257087 20:64158365-64158387 ACAGACAGGTTGGGCAGGTGGGG - Intronic
1176257185 20:64158635-64158657 ACAGACAGGTTGGGCAGGTGAGG - Intronic
1176410478 21:6447119-6447141 ACAGAGGGGTGAGCAAGGTGCGG + Intergenic
1178671331 21:34594261-34594283 AAAGAAGGGTGGGCCGGGCGCGG + Intronic
1179218113 21:39384548-39384570 AAAAAATTGTCGGCCAGGTGTGG - Intronic
1179685971 21:43055441-43055463 ACAGAGGGGTGAGCAAGGTGCGG + Intronic
1179769937 21:43606994-43607016 ACAGAACTGGAGGCCAGGTGTGG + Intronic
1179966174 21:44807484-44807506 ACAGAAGGGCCCGTCAAGTGAGG + Intronic
1180939589 22:19649694-19649716 ATAGAAGAGTTGGCCAGGTGTGG + Intergenic
1180979122 22:19870447-19870469 ACAGAAGGGTGGTCAGGGTGCGG + Intergenic
1181004632 22:20006918-20006940 TCAAAAGGGTAGGCCAGGCGCGG - Intronic
1181084798 22:20434882-20434904 GCAGGAGGGTCGGGCTGGTGTGG - Intronic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181676597 22:24457978-24458000 AAAAAAGTGTTGGCCAGGTGTGG - Intergenic
1181874127 22:25926583-25926605 ACAAAACTTTCGGCCAGGTGTGG - Intronic
1183442098 22:37829080-37829102 ACTGAAGAGTCGGGGAGGTGCGG - Intergenic
1183530777 22:38352147-38352169 ACAGAAGGGACCGCCAGTTCTGG + Intronic
1183550019 22:38476812-38476834 AAAAAAGGGGGGGCCAGGTGTGG - Intronic
1183811056 22:40257730-40257752 AATGAATGGACGGCCAGGTGCGG + Intronic
1184002168 22:41682937-41682959 AAAGAAAGGATGGCCAGGTGCGG - Intronic
1184125596 22:42484434-42484456 ACAGAAAGGGAGGCCAGGCGTGG - Intergenic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
1184218074 22:43080580-43080602 AGGAAAGGGTCGGGCAGGTGTGG - Intronic
1184307150 22:43612599-43612621 ACTAAAAAGTCGGCCAGGTGTGG + Intronic
1184313639 22:43665322-43665344 ACAGAAGGATGGGCCAGGTAAGG + Intronic
1184496385 22:44844751-44844773 AAAGAAATGTTGGCCAGGTGCGG - Intronic
1184504123 22:44890909-44890931 ACAAGAGGGTGGGCAAGGTGTGG + Intronic
1184710401 22:46246313-46246335 AAAGGTGGGTGGGCCAGGTGGGG - Intronic
1184782186 22:46654997-46655019 ACAGAAGGCTACGCCAGATGGGG + Intronic
1185290877 22:50026941-50026963 AAAAAAAAGTCGGCCAGGTGCGG + Intronic
1185419944 22:50729567-50729589 ACACAATGGGCAGCCAGGTGTGG - Intergenic
949234723 3:1794271-1794293 GTATAAGGGTCAGCCAGGTGTGG + Intergenic
949277393 3:2300857-2300879 AAAGAAGGATCGGCCAGGCACGG - Intronic
949477115 3:4458563-4458585 AAAGAAAACTCGGCCAGGTGCGG + Intronic
950489583 3:13295557-13295579 ACAGCAGGGTGGGCCAGGTGCGG - Intergenic
950709079 3:14802392-14802414 AGGGAAGGGTCGGCCCTGTGAGG + Intergenic
951504533 3:23428682-23428704 ACAAAAGAGAGGGCCAGGTGTGG + Intronic
951565182 3:24005810-24005832 AAAGAGGGAGCGGCCAGGTGCGG - Intergenic
953277151 3:41513345-41513367 TCAGCAGAGTTGGCCAGGTGTGG + Intronic
953583445 3:44178001-44178023 ACAGAAGGGTGGGTCACCTGGGG - Intergenic
953908305 3:46879450-46879472 ACAGAGGCATAGGCCAGGTGCGG + Intronic
953964263 3:47290750-47290772 AGACAAGGCTGGGCCAGGTGTGG - Intronic
954022820 3:47757484-47757506 TCAGAACGCTCAGCCAGGTGTGG + Intronic
954166171 3:48760065-48760087 ACAAAAATGTAGGCCAGGTGTGG + Intronic
954657772 3:52207291-52207313 ACAAAAAGTTAGGCCAGGTGCGG - Intronic
954814754 3:53271742-53271764 AAAAAAGAGTCGGCCAGGCGCGG - Intergenic
955262226 3:57404423-57404445 ACAAAAGTTTCGGCCAGGTGTGG + Intronic
955342611 3:58137008-58137030 ACTGAAAGGCCGGCCAGGCGTGG - Intronic
955574737 3:60348047-60348069 ATGAAAGGGTAGGCCAGGTGTGG - Intronic
955985781 3:64572787-64572809 AAAGCAGGGGCGGCCGGGTGCGG + Intronic
956654127 3:71532750-71532772 ACAGAAGGGCGGGGCAGGTGGGG - Intronic
958597393 3:96245091-96245113 AAAGAATGCTAGGCCAGGTGCGG - Intergenic
959669129 3:108955020-108955042 AGAGAACTGTAGGCCAGGTGTGG - Intergenic
960107675 3:113815678-113815700 ACAGGAGGGTAGGCCGGGTGCGG + Intergenic
960270415 3:115667947-115667969 ACAGAAGGGCTGGCAAAGTGAGG - Intronic
960377182 3:116917701-116917723 AAAGAAAAGTCGGCCAGGTGTGG + Intronic
961766309 3:129213876-129213898 ACCAAAGTGTTGGCCAGGTGTGG - Intergenic
961850901 3:129817291-129817313 CCATAAGAGTCGGCCGGGTGTGG + Intronic
962932686 3:140052444-140052466 ACAGAAATATTGGCCAGGTGCGG - Intronic
963153348 3:142070195-142070217 AAAGAAGTTTGGGCCAGGTGCGG - Intronic
963321981 3:143818789-143818811 ACTGGAGGATCGGCCAGGCGCGG + Intronic
963621308 3:147609840-147609862 AGAGGAGGGTGGGCCGGGTGCGG - Intergenic
964191071 3:154001540-154001562 ACAGAAAGGTGGGGAAGGTGGGG + Intergenic
964240493 3:154587083-154587105 AAAGAACTCTCGGCCAGGTGTGG - Intergenic
964280479 3:155058970-155058992 AAAGAAGGATTGGCCAGGTGTGG + Intronic
964358061 3:155868634-155868656 ACAGACTTGTTGGCCAGGTGCGG - Intergenic
964737182 3:159929112-159929134 ACAAAAGAGTTAGCCAGGTGTGG + Intergenic
964744605 3:160000677-160000699 AAAGAAGTCTCAGCCAGGTGTGG + Intergenic
966144956 3:176800654-176800676 ACAGCAGAATAGGCCAGGTGTGG + Intergenic
966444049 3:179980749-179980771 ACAGCAGAGTTGGCCAGGAGCGG + Intronic
966689345 3:182726939-182726961 ACAGAAGGGGCGGGGCGGTGGGG - Intergenic
966691085 3:182742378-182742400 AGAGCAGGGTCAGCCAGGTGCGG + Intergenic
966845291 3:184124340-184124362 ACAGAAAGTTCGGCCGGGCGCGG + Intergenic
966869213 3:184279017-184279039 AAAGAAGTTTAGGCCAGGTGCGG + Intronic
966910147 3:184555103-184555125 ACCCAGGGGGCGGCCAGGTGTGG + Intronic
966993964 3:185262232-185262254 CAAGAAGGGTTGGCCAGGTGCGG + Intronic
967184670 3:186934244-186934266 CCAGCAGGCTGGGCCAGGTGTGG + Intronic
967291008 3:187920411-187920433 AAAGAAGGATTGGCCAGGTGCGG + Intergenic
967307023 3:188069278-188069300 ACAGAAATATCAGCCAGGTGTGG - Intergenic
969038979 4:4279032-4279054 AAAGAAGGCTGGGCCAGGTGCGG + Intronic
969608029 4:8211961-8211983 ACAGGAGGGAGGGCCAGGTGTGG + Intronic
970315667 4:14826395-14826417 AAAGAAGGAGAGGCCAGGTGTGG - Intergenic
970936069 4:21571258-21571280 ACAGAAGAGTCTACCAGGAGTGG + Intronic
970975570 4:22039455-22039477 AAAGAATTTTCGGCCAGGTGTGG - Intergenic
971284557 4:25275092-25275114 ACAGAAACGTTGACCAGGTGTGG - Intronic
971910630 4:32792381-32792403 ACAGGGGAGTAGGCCAGGTGAGG - Intergenic
971926462 4:33015344-33015366 ACAGAATGTTAGGCCAGGCGTGG - Intergenic
973137730 4:46728380-46728402 ACAGATGTGTAGGCCAGGTGTGG + Intergenic
973738880 4:53900727-53900749 ATGGATGGGTCGGCCTGGTGTGG + Intronic
974007854 4:56577112-56577134 ACTGAAGGATTGGCGAGGTGTGG + Intronic
974981217 4:68959829-68959851 ACAGAAGGATGGGTCAGGTGTGG + Intergenic
975372259 4:73602796-73602818 ACACAAGTTTCGGCCAGGCGCGG + Intronic
975643734 4:76526075-76526097 AAATAAATGTCGGCCAGGTGCGG + Intronic
975712382 4:77173579-77173601 AAAGAAGGTTGGGCTAGGTGTGG - Intronic
976650971 4:87434332-87434354 AAACAAGTGTAGGCCAGGTGTGG - Intronic
977943124 4:102879490-102879512 ACACAAAGCTTGGCCAGGTGCGG + Intronic
978009966 4:103668555-103668577 ACAGTTGTTTCGGCCAGGTGTGG + Intronic
979533974 4:121798779-121798801 ACAGAAGGTGAGGCCAGGTGCGG + Intergenic
980983086 4:139670621-139670643 AGAGAAGGGGTGGCCAGGTGTGG + Intronic
981311107 4:143298990-143299012 AAAGAAAGGCAGGCCAGGTGTGG + Intergenic
984374635 4:178911965-178911987 AAGGAAAGGTAGGCCAGGTGCGG + Intergenic
984919293 4:184749815-184749837 ACAGAAGTACCGGCCAGGCGCGG + Intergenic
985177767 4:187220944-187220966 AGAAAAGGATGGGCCAGGTGTGG + Intergenic
985209420 4:187576361-187576383 ACATAAGTTTTGGCCAGGTGTGG - Intergenic
986200415 5:5573810-5573832 ACTTAGGGGTCTGCCAGGTGGGG + Intergenic
986350592 5:6875605-6875627 ACAGAATGGAAGGGCAGGTGCGG - Intergenic
988461364 5:31441128-31441150 AAAAAAGGGCAGGCCAGGTGTGG + Intronic
989387681 5:40869435-40869457 ATAGAATGGTAGGCCAGGTGTGG - Intergenic
990979431 5:61588630-61588652 TCAGAAGGGTGAGACAGGTGAGG + Intergenic
991665932 5:69000045-69000067 AAAGAAGTATTGGCCAGGTGTGG - Intergenic
991688071 5:69199820-69199842 ACAGAAGGGTCAGGCCGGTGCGG + Intronic
992064548 5:73093975-73093997 AGAAAAGTGTCGGCCGGGTGCGG + Intergenic
992643327 5:78788920-78788942 ACAAAAATGTAGGCCAGGTGTGG - Intronic
993348757 5:86820408-86820430 AGAGAAGCGTAGGCCAGGCGCGG - Intergenic
994164252 5:96592243-96592265 ACAGGGGGATTGGCCAGGTGTGG + Intronic
995137663 5:108697467-108697489 AGAGAAAGAGCGGCCAGGTGGGG - Intergenic
995514488 5:112940294-112940316 ACATAAAAGTTGGCCAGGTGTGG - Intergenic
995600588 5:113791145-113791167 GCAGAAGGGTAGGGCAGATGTGG - Intergenic
995994564 5:118282972-118282994 CCAGAAGGGGCGGCCGGGCGGGG - Intergenic
997163242 5:131631784-131631806 ACAAAAAGGTAGGCCAGGCGTGG + Intronic
997823322 5:137085200-137085222 AGCGTAGGGTGGGCCAGGTGGGG - Intronic
997856583 5:137378232-137378254 ATGGAAGGGAAGGCCAGGTGCGG - Intronic
997910985 5:137873237-137873259 ACAGTAGGCTAGGCCAGGTGTGG + Intronic
997987384 5:138513492-138513514 ACAGTATGGTGGGCCGGGTGCGG - Intronic
999315072 5:150578416-150578438 ACAGCAGTTTCGGCCGGGTGCGG + Intergenic
1000980962 5:167816194-167816216 ACAGAAGGGAGGGGAAGGTGTGG + Intronic
1001122534 5:168992135-168992157 ACAGAAGGGTGGCTCAGGAGAGG - Intronic
1001556246 5:172639489-172639511 AAAGGAGGATCAGCCAGGTGAGG + Intergenic
1001810290 5:174622451-174622473 AAAGAAGGGCAGGCCAGGAGGGG + Intergenic
1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG + Intronic
1003550320 6:7097546-7097568 AAATAAGGGACGGCCAGGCGCGG - Intergenic
1003939603 6:11011072-11011094 ATTGAAGGGTTGGCCAGGCGCGG + Intronic
1003990448 6:11481577-11481599 ACAGAACAGTTAGCCAGGTGTGG + Intergenic
1004197536 6:13518489-13518511 AAAGAAAAGTCGGCCCGGTGCGG + Intergenic
1004691528 6:17996373-17996395 AAAGGATGGTCAGCCAGGTGTGG - Intergenic
1004927205 6:20427408-20427430 GAAGAAGGGTCGGCCAGGGCAGG + Intronic
1005126294 6:22450316-22450338 ACAGAAAAGTTAGCCAGGTGTGG - Intergenic
1005306392 6:24518078-24518100 ATAGAAGGGTGGGCTAGGTCAGG + Intronic
1006183018 6:32165257-32165279 ACAGGAGGGTTGGCCAGGCATGG + Intronic
1006330584 6:33387765-33387787 ATGGAATGGTAGGCCAGGTGCGG + Intergenic
1007815902 6:44525452-44525474 AAGGAAGGGTTGGCCAGCTGGGG - Intergenic
1007882456 6:45182550-45182572 AAAGAAAGGCAGGCCAGGTGCGG - Intronic
1008149295 6:47931073-47931095 ACACAATGCTCGGCCGGGTGCGG - Intronic
1008673108 6:53793871-53793893 AACGAAGGGGCGGCCGGGTGGGG + Intergenic
1009320796 6:62286137-62286159 ACGGAAGGGACGGGCAGGTGTGG - Exonic
1010003456 6:70971107-70971129 ACTGAAGTGTAGGCCAGGCGTGG - Intergenic
1010892020 6:81325028-81325050 GGAGAAGGGTCGGCTGGGTGCGG - Intergenic
1011402594 6:86980095-86980117 AAAACAGGGTCGGCCAGGCGCGG + Intronic
1012971807 6:105739198-105739220 AGAACAGGGTAGGCCAGGTGCGG + Intergenic
1013015162 6:106154501-106154523 ACGGGAGGGTCGGACAGGGGCGG - Intergenic
1013480194 6:110546412-110546434 AGAAAAGGGTGGGCCAGGTGTGG - Intergenic
1013517654 6:110903049-110903071 ACAGAAGTCTAGGCCAGGCGTGG - Intergenic
1014106853 6:117574788-117574810 AAAAAAGAGTAGGCCAGGTGCGG + Intronic
1015167606 6:130215699-130215721 ACAGAAGGGGTGGGCAGGAGAGG + Intronic
1017689712 6:156951731-156951753 AATGAAGTGTTGGCCAGGTGCGG - Intronic
1017894287 6:158665817-158665839 ACAGAAGTTTGGGCCAAGTGTGG + Intronic
1017897826 6:158696491-158696513 AAATAAGTGTTGGCCAGGTGCGG - Intronic
1018860689 6:167708876-167708898 ACAGAAGGGAAGGCCAGTGGAGG + Intergenic
1018886860 6:167946288-167946310 ACAGAAGCGGCCGCCAGGAGCGG + Intronic
1019186463 6:170223411-170223433 TCAGAAGGGTTGGCCAGCAGAGG - Intergenic
1019483724 7:1278045-1278067 ACCGATGGGTGGGCCAGGCGCGG + Intergenic
1020662972 7:11004090-11004112 ACAGAAAAATCAGCCAGGTGTGG + Intronic
1021205009 7:17769487-17769509 ACAGAATGCGAGGCCAGGTGCGG - Intergenic
1021275707 7:18648284-18648306 ACAGAAGAATAGGTCAGGTGTGG - Intronic
1021700906 7:23318513-23318535 AAATAAAGGTTGGCCAGGTGCGG - Intronic
1022014764 7:26339835-26339857 AAAAAAAGATCGGCCAGGTGGGG - Intronic
1023629352 7:42148288-42148310 ACAGAGGGCTCCGCCACGTGTGG + Exonic
1023897104 7:44442990-44443012 AGAAAAGGGGAGGCCAGGTGCGG - Intronic
1024285653 7:47755345-47755367 ACAGAATCATGGGCCAGGTGAGG - Intronic
1024911865 7:54455793-54455815 CCAGAAGCCTGGGCCAGGTGTGG - Intergenic
1025678155 7:63659990-63660012 ACAGGAGTGTAGGCCAGGCGTGG - Intergenic
1025696210 7:63776339-63776361 AGAAAATGGTAGGCCAGGTGTGG - Intergenic
1029278326 7:99420664-99420686 ACAAAAGGTTTGGCCGGGTGCGG + Intronic
1029387738 7:100254821-100254843 ACAAAAAGATCAGCCAGGTGTGG + Intronic
1029428156 7:100510410-100510432 ACAGCAGGTTAGGCCACGTGTGG + Intergenic
1029455701 7:100670633-100670655 ACAGAATGATCTGCCTGGTGGGG - Intergenic
1029533224 7:101139308-101139330 TCAGAAGCCTAGGCCAGGTGTGG + Intergenic
1030009833 7:105154961-105154983 GAATAAGGGTGGGCCAGGTGCGG - Intronic
1031525852 7:122820847-122820869 ACAGTAAGGTCGGCCGGGCGCGG - Intronic
1031602742 7:123732035-123732057 ACAGAAAAGGCGGCCAGGCGCGG + Intronic
1031738570 7:125398574-125398596 ACAGAAAGAAGGGCCAGGTGCGG + Intergenic
1033533895 7:142294070-142294092 AGTTAAGGGTGGGCCAGGTGTGG - Intergenic
1033718476 7:144029410-144029432 AAAGAAGGTTCGGCCGGGCGCGG + Intergenic
1033911516 7:146269049-146269071 ATAAGAGGGTGGGCCAGGTGGGG + Intronic
1034121416 7:148631454-148631476 AAAGAAGAGGGGGCCAGGTGTGG + Intergenic
1035202180 7:157274751-157274773 AAAGAAGTGTGGGCCAGGCGCGG + Intergenic
1036654743 8:10670954-10670976 AGTTAAGAGTCGGCCAGGTGGGG + Intronic
1037091624 8:14926927-14926949 ATCAAAGTGTCGGCCAGGTGTGG - Intronic
1037725425 8:21479111-21479133 AGAGAAGGGCAGGCCAGGGGTGG - Intergenic
1038189160 8:25303242-25303264 AAAGGAGCGTGGGCCAGGTGAGG - Intronic
1038911997 8:31975210-31975232 AAAGAAGGTTCGGAGAGGTGGGG + Intronic
1039085042 8:33771565-33771587 ATAAAAGGTTGGGCCAGGTGGGG + Intergenic
1039369494 8:36970543-36970565 ACAGAAGGATTGGCCAGTGGAGG + Intergenic
1039563895 8:38535953-38535975 ATAAAAGAGTCAGCCAGGTGTGG - Intergenic
1040779260 8:51088469-51088491 ACATCAGTGTCGGCCGGGTGCGG + Intergenic
1040967678 8:53100755-53100777 ACAAAAGGGTGGGCAGGGTGGGG + Intergenic
1041497492 8:58503069-58503091 ACTGAAGGCCTGGCCAGGTGTGG - Intergenic
1044700624 8:94962581-94962603 ACAGAAGTCTGGGCTAGGTGTGG - Intronic
1045007338 8:97928050-97928072 CATGAAGGGTCGGGCAGGTGTGG + Intronic
1045735622 8:105293286-105293308 AAAGAAGAGTGGGCCTGGTGCGG + Intronic
1046461484 8:114542744-114542766 AATGAAGGGAGGGCCAGGTGTGG + Intergenic
1047385521 8:124405754-124405776 AAAGAAGATTGGGCCAGGTGCGG - Intergenic
1047593247 8:126349646-126349668 AAAGAATAGTCGGCCAGGCGCGG + Intergenic
1047981762 8:130190804-130190826 ACAGATGCATAGGCCAGGTGCGG - Intronic
1048088878 8:131217308-131217330 ATAGAAGTGTCTGGCAGGTGGGG + Intergenic
1048498630 8:134956422-134956444 AGAGATGGGGAGGCCAGGTGAGG - Intergenic
1049319414 8:141988037-141988059 TCTGAAGGGAAGGCCAGGTGCGG - Intergenic
1050211646 9:3265247-3265269 ACAGTAGGGCCAGCCACGTGTGG - Intronic
1050304468 9:4294216-4294238 ACAGAATAATGGGCCAGGTGCGG + Intronic
1050737696 9:8782884-8782906 AAAGAAGTGTAGGCCAGGCGTGG - Intronic
1051086997 9:13361469-13361491 ACAGAAGGGCCAACCAGCTGAGG - Intergenic
1052948619 9:34189477-34189499 ACATAATGATCGGCCGGGTGCGG - Intronic
1053162749 9:35824969-35824991 ACAGAAGGGTCGGCTGGGCGCGG - Intronic
1053189195 9:36047316-36047338 AAGAAAGCGTCGGCCAGGTGTGG + Intronic
1056168554 9:83960909-83960931 AATGGAGGGTCGGCCAGGTGTGG + Intergenic
1056510762 9:87302850-87302872 AAAGAAGACTTGGCCAGGTGTGG - Intergenic
1056875932 9:90330388-90330410 ACAGAAGCCTCGGGAAGGTGTGG - Intergenic
1057016243 9:91655477-91655499 AGAGCAGGGGAGGCCAGGTGCGG + Intronic
1057100085 9:92351198-92351220 ACAGAAACTTTGGCCAGGTGTGG + Intronic
1057146142 9:92760678-92760700 ACAGATGGGTCTGACAGTTGGGG - Intronic
1057174437 9:92985766-92985788 ACAGAAAAATGGGCCAGGTGCGG - Intronic
1058082663 9:100716179-100716201 AGAGAAGAGGTGGCCAGGTGCGG - Intergenic
1058104679 9:100956591-100956613 ACCAAAGGATGGGCCAGGTGTGG + Intergenic
1058594162 9:106597286-106597308 ACAGAAGGGCCAGAAAGGTGAGG + Intergenic
1059153953 9:111973543-111973565 ACAAAAGGATTAGCCAGGTGTGG - Intergenic
1059564802 9:115373257-115373279 AGAGAAAGGAGGGCCAGGTGTGG + Intronic
1060002412 9:119970373-119970395 ACAGAATCATTGGCCAGGTGTGG - Intergenic
1060447642 9:123706479-123706501 AGAGAAGGGTCGGCTGGGCGCGG + Intronic
1060500748 9:124152309-124152331 ACAGAAGGAAGGGCCAGGTGTGG + Intergenic
1060848214 9:126854058-126854080 AAAGCAAGGTCAGCCAGGTGTGG + Intergenic
1061168160 9:128936527-128936549 CCAGGAGGGTGGGCCATGTGTGG + Intronic
1061325203 9:129859562-129859584 ACAGAAGGAGAGGCCAGGTGCGG - Intronic
1061563343 9:131420771-131420793 AAGCAAGGGTAGGCCAGGTGTGG - Intronic
1062107168 9:134762048-134762070 ACAGAAGAGAGGCCCAGGTGTGG + Intronic
1062428859 9:136518102-136518124 ACAGGGGGTGCGGCCAGGTGGGG - Intronic
1062663433 9:137652879-137652901 ACAGAAAAGTTAGCCAGGTGTGG - Intronic
1185661306 X:1731034-1731056 AAAAAAGGGTCGGCCGGGTGCGG + Intergenic
1187064708 X:15822278-15822300 AGAGAAGGCGTGGCCAGGTGCGG - Intronic
1187493525 X:19774916-19774938 ATAGAAGGTCTGGCCAGGTGTGG - Intronic
1187842251 X:23500732-23500754 AAAGAAAAGTTGGCCAGGTGCGG - Intergenic
1187892171 X:23946572-23946594 ACAGCATGGTTGGCCAGGCGCGG + Intergenic
1187899251 X:24011857-24011879 ACGGTAGAGTAGGCCAGGTGCGG + Intronic
1188089395 X:25944725-25944747 AAAGAAGGCTCGGCCGGGCGCGG + Intergenic
1188396095 X:29685694-29685716 ACAGAAGTATTGGCCAGGTGCGG + Intronic
1188417273 X:29950966-29950988 ACATTAGGGTTGGCCAGGTGTGG - Intronic
1189314600 X:40045787-40045809 ACTGATGGCCCGGCCAGGTGCGG + Intergenic
1189990028 X:46585578-46585600 ATGGGAGGGTGGGCCAGGTGTGG - Intronic
1190378908 X:49818811-49818833 AAAGAAAAGTTGGCCAGGTGTGG + Intergenic
1190585377 X:51934821-51934843 TGAGAAGTGTCAGCCAGGTGTGG + Intergenic
1190823771 X:53998161-53998183 AAAGAAAGGCAGGCCAGGTGTGG + Intronic
1191995471 X:67090726-67090748 ACAGAAATGTAGGCCAGGTCTGG + Intergenic
1192134817 X:68587145-68587167 ACACAAAGGTTAGCCAGGTGTGG + Intergenic
1192327067 X:70142040-70142062 AGAGAAGAGTAGGCCAGGTGTGG + Intronic
1192605000 X:72507137-72507159 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1192606916 X:72528064-72528086 ACAGAAAGGTGGGCCAGGCATGG - Intronic
1194683458 X:96882801-96882823 ACAAAAAAGTCAGCCAGGTGTGG + Intronic
1195057454 X:101159750-101159772 ACCAAAGAGTCAGCCAGGTGCGG - Intronic
1195198885 X:102527079-102527101 ACAGTAGGGAGGGCCGGGTGTGG - Intergenic
1195467881 X:105200619-105200641 AAAGAATGATTGGCCAGGTGCGG + Intronic
1195682736 X:107560977-107560999 ACATACGGCTTGGCCAGGTGTGG + Intronic
1196412390 X:115433781-115433803 ACACTAGGGATGGCCAGGTGTGG - Intergenic
1196648024 X:118139290-118139312 AAAGAAGAGTTGGCTAGGTGCGG - Intergenic
1196722043 X:118863646-118863668 ATAGAAGTGTTAGCCAGGTGCGG + Intergenic
1196793630 X:119485622-119485644 GCGGAAGGGTGGGCCAGGTGTGG + Intergenic
1196837370 X:119825866-119825888 ACTGAAGAGTCAGCCAGGTGTGG + Intergenic
1196848617 X:119916789-119916811 ACAGAAGAATGGGCCAGGCGCGG - Intronic
1199353452 X:146832185-146832207 ACAGAAGTGCAAGCCAGGTGCGG + Intergenic
1200211381 X:154348185-154348207 ACAGCAGGCCCGGCCGGGTGTGG - Intergenic
1200848911 Y:7862240-7862262 AAAGAAGAGTCAGCCAGGTGTGG + Intergenic
1201665040 Y:16442188-16442210 AAAGAAGAGTGGTCCAGGTGTGG + Intergenic